> >>ZC3HAV1L-zinc finger CCCH-type, antiviral 1-like Gene
ZC3HAV1L-zinc finger CCCH-type, antiviral 1-like Gene View larger

ZC3HAV1L-zinc finger CCCH-type, antiviral 1-like Gene

PTXBC020784

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of ZC3HAV1L-zinc finger CCCH-type, antiviral 1-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZC3HAV1L-zinc finger CCCH-type, antiviral 1-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020784
Product type: DNA & cDNA
Ncbi symbol: ZC3HAV1L
Origin species: Human
Product name: ZC3HAV1L-zinc finger CCCH-type, antiviral 1-like Gene
Size: 2ug
Accessions: BC020784
Gene id: 92092
Gene description: zinc finger CCCH-type, antiviral 1-like
Synonyms: C7orf39; zinc finger CCCH-type antiviral protein 1-like; zinc finger CCCH-type, antiviral 1-like; zinc finger CCCH-type containing, antiviral 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagcccacagtgtgctccttcctcaccaaggtgctgtgcgcccacggcggccgcatgttcctgaaggacctgcgcggccacgtggagctgtcggaggccaggctccgggacgtgctgcagcgcgccgggcccgagcgtttcctgctgcaggaggtggagacgcaggagggcctcggggacgcggaggccgaggcggcggccggcgcggtgggcggtggcggcacctccgcctggagggtggtggccgtgtccgggactataggtgcatgccaccatactcagctaatctttttaggtttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor protein, translationally-controlled 1
- lectin, galactoside-binding, soluble, 14
- phosphodiesterase 4D interacting protein
- WNT1 inducible signaling pathway protein 2

Reviews

Buy ZC3HAV1L-zinc finger CCCH-type, antiviral 1-like Gene now

Add to cart