Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ACP5-acid phosphatase 5, tartrate resistant Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ACP5-acid phosphatase 5, tartrate resistant Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025414 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACP5 |
| Origin species: | Human |
| Product name: | ACP5-acid phosphatase 5, tartrate resistant Gene |
| Size: | 2ug |
| Accessions: | BC025414 |
| Gene id: | 54 |
| Gene description: | acid phosphatase 5, tartrate resistant |
| Synonyms: | HPAP; TRACP5a; TRACP5b; TRAP; TrATPase; tartrate-resistant acid phosphatase type 5; human purple acid phosphatase; tartrate-resistant acid ATPase; tartrate-resistant acid phosphatase 5a; tartrate-resistant acid phosphatase 5b; acid phosphatase 5, tartrate resistant |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacatgtggacggcgctgctcatcctgcaagccttgttgctaccctccctggctgatggtgccacccctgccctgcgctttgtagccgtgggtgactggggaggggtccccaatgccccattccacacggcccgggaaatggccaatgccaaggagatcgctcggactgtgcagatcctgggtgcagacttcatcctgtctctaggggacaatttttacttcactggtgtgcaagacatcaatgacaagaggttccaggagacctttgaggacgtattctctgaccgctcccttcgcaaagtgccctggtacgtgctagccggaaaccatgaccaccttggcaatgtctctgcccagattgcatactctaagatctccaagcgctggaacttccccagccctttctaccgcctgcacttcaagatcccacagaccaatgtgtctgtggccatttttatgctggacacagtgacactatgtggcaactcagatgacttcctcagccagcagcctgagaggccccgagacgtgaagctggcccgcacacagctgtcctggctcaagaaacagctggcggcggccagggaggactacgtgctggtggctggccactaccccgtgtggtccatagccgagcacgggcctacccactgcctggtcaagcagctacggccactgctggccacatacggggtcactgcctacctgtgcggccacgatcacaatctgcagtacctgcaagatgagaatggcgtgggctacgtgctgagtggggctgggaatttcatggacccctcaaagcggcaccagcgcaaggtccccaacggctatctgcgcttccactatgggactgaagactcactgggtggctttgcctatgtggagatcagctccaaagagatgactgtcacttacatcgaggcctcgggcaagtccctctttaagaccaggctgccgaggcgagccaggccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 35, member B2 - xin actin-binding repeat containing 2 - interleukin 1 family, member 7 (zeta) - basic leucine zipper nuclear factor 1 |