Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HMG20B-high-mobility group 20B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HMG20B-high-mobility group 20B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021585 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HMG20B |
| Origin species: | Human |
| Product name: | HMG20B-high-mobility group 20B Gene |
| Size: | 2ug |
| Accessions: | BC021585 |
| Gene id: | 10362 |
| Gene description: | high-mobility group 20B |
| Synonyms: | BRAF25; BRAF35; HMGX2; HMGXB2; PP7706; SMARCE1r; SOXL; pp8857; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1-related; BRCA2-associated factor 35; HMG box domain containing 2; HMG box-containing protein 20B; HMG domain-containing protein 2; HMG domain-containing protein HMGX2; SMARCE1-related protein; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E, member 1-related; Sox-like transcriptional factor; structural DNA-binding protein BRAF35; high mobility group 20B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgggcgccgagtggagcaagctgcagccaacggaaaagcagcggtacctggatgaggccgagagagagaagcagcagtacatgaaggagctgcgggcgtaccagcagtctgaagcctataagatgtgcacggagaagatccaggagaagaagatcaagaaagaagactcgagctctgggctcatgaacactctcctgaatggacacaagggtggggactgcgatggcttctccaccttcgatgttcccatcttcactgaagagttcttggaccaaaacaaagcgcgtgaggcggagcttcggcgcttgcggaagatgaatgtggccttcgaggagcagaacgcggtactgcagaggcacacgcagagcatgagcagcgcgcgcgagcgtctggagcaggagctggcgctggaggagcggaggacgctggcgctgcagcagcagctccaggccgtgcgccaggcgctcaccgccagcttcgcctcactgccggtgccgggcacgggcgaaacgcccacgctgggcactctggacttctacatggcccggcttcacggagccatcgagcgcgaccccgcccagcacgagaagctcatcgtccgcatcaaggaaatcctggcccaggtcgccagcgagcacctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FtsJ homolog 1 (E. coli) - vaccinia related kinase 3 - zinc finger protein 187 - FtsJ homolog 3 (E. coli) |