Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLR2J-polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa Gene
PTXBC024165
New product
Data sheet of POLR2J-polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR2J-polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024165 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR2J |
| Origin species: | Human |
| Product name: | POLR2J-polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa Gene |
| Size: | 2ug |
| Accessions: | BC024165 |
| Gene id: | 5439 |
| Gene description: | polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa |
| Synonyms: | POLR2J1; RPB11; RPB11A; RPB11m; hRPB14; DNA-directed RNA polymerase II subunit RPB11-a; DNA-directed RNA polymerase II subunit J-1; RNA polymerase II 13.3 kDa subunit; RNA polymerase II subunit B11-a; polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa; polymerase (RNA) II subunit J; RNA polymerase II subunit J |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacgcccctccagccttcgagtcgttcttgctcttcgagggcgagaagaagatcaccattaacaaggacaccaaggtacccaatgcctgtttattcaccatcaacaaagaagaccacacactgggaaacatcattaaatcacaactcctaaaagacccgcaagtgctatttgctggctacaaagtcccccaccccttggagcacaagatcatcatccgagtgcagaccacgccggactacagcccccaggaagcctttaccaacgccatcaccgacctcatcagtgagctgtccctgctggaggagcgctttcgggtggccataaaagacaagcaggaaggaattgagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor necrosis factor receptor superfamily, member 11b - solute carrier family 31 (copper transporters), member 2 - LysM, putative peptidoglycan-binding, domain containing 3 - hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse) |