Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TWIST2-twist homolog 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TWIST2-twist homolog 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017907 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TWIST2 |
| Origin species: | Human |
| Product name: | TWIST2-twist homolog 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC017907 |
| Gene id: | 117581 |
| Gene description: | twist homolog 2 (Drosophila) |
| Synonyms: | AMS; BBRSAY; DERMO1; FFDD3; SETLSS; bHLHa39; twist-related protein 2; class A basic helix-loop-helix protein 39; dermis-expressed protein 1; twist basic helix-loop-helix transcription factor 2; twist homolog 2; twist-related bHLH protein Dermo1; twist family bHLH transcription factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagggctccagctcgcccgtgtcccccgtggacagcctgggcaccagcgaggaggagctcgagaggcagcccaagcgcttcggccggaagcggcgctacagcaagaagtcgagcgaagatggcagcccgaccccgggcaagcgcggcaagaagggcagccccagcgcgcagtccttcgaggagctgcagagccagcgcatcctggccaacgtgcgcgagcgccagcgcacccagtcgctcaacgaggccttcgcggcgctgcgcaagatcatccccacgctgccctctgacaagctgagcaagatccagacgctcaagctggccgccaggtacatagacttcctctaccaggtcctgcagagcgacgagatggacaataagatgaccagctgcagctacgtggcccacgagcgcctcagctacgccttctccgtgtggcgcatggagggcgcgtggtccatgtccgcctcccactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - asialoglycoprotein receptor 1 - transmembrane protein 167A - hepcidin antimicrobial peptide - Wolfram syndrome 1 (wolframin) |