Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of LRRC29-leucine rich repeat containing 29 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LRRC29-leucine rich repeat containing 29 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018785 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LRRC29 |
| Origin species: | Human |
| Product name: | LRRC29-leucine rich repeat containing 29 Gene |
| Size: | 2ug |
| Accessions: | BC018785 |
| Gene id: | 26231 |
| Gene description: | leucine rich repeat containing 29 |
| Synonyms: | FBL9; FBXL9; leucine-rich repeat-containing protein 29; F-box and leucine-rich repeat protein 9; F-box protein FBL9; F-box/LRR-repeat protein 9; leucine rich repeat containing 29 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtacagctctgggtggcctgcaggagctgcagagcctcgacatggccgagggcgggaactggcccaggccctgggctgtatgcacggggctccatcccagctggcctccctcagcctggcccactgctcttcattgaagtcacgcccagagctggagcatcaggcctcaggtaccaaggacgcctgtccagagccacagggcccctccctgctcacgctgcgggccctgcaggagttggacctcacagcctgcagcaagctgactgatgccagtttagccaaggtgctccagtttctccagctgaggcagctgtcccttagcctgttgccagaactcacagacaacggcttggttgctgtggccaggggctgtcctagcctggagcacttggcgctgagtcactgcagccgactcagtgacaagggctgggcccaggcagccagctcctggccaaggctgcagcatctcaacctgtccagctgcagtcagctcatagagcagacactggatgctattgggcaggcgtgcaggcagctccgggtgttggatgtggccacgtgccctggcatcaacatggccgccgtcagacgcttccaagcccagctgccccaggtgtcctgtgtccagtcccgcttcgtgggaggggctgacctgaccctaacactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - WD repeat and SOCS box-containing 1 - fibroblast activation protein, alpha - retinol binding protein 5, cellular - ribosomal protein S2 pseudogene |