PTXBC018785
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC018785 |
Product type: | DNA & cDNA |
Ncbi symbol: | LRRC29 |
Origin species: | Human |
Product name: | LRRC29-leucine rich repeat containing 29 Gene |
Size: | 2ug |
Accessions: | BC018785 |
Gene id: | 26231 |
Gene description: | leucine rich repeat containing 29 |
Synonyms: | FBL9; FBXL9; leucine-rich repeat-containing protein 29; F-box and leucine-rich repeat protein 9; F-box protein FBL9; F-box/LRR-repeat protein 9; leucine rich repeat containing 29 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgtacagctctgggtggcctgcaggagctgcagagcctcgacatggccgagggcgggaactggcccaggccctgggctgtatgcacggggctccatcccagctggcctccctcagcctggcccactgctcttcattgaagtcacgcccagagctggagcatcaggcctcaggtaccaaggacgcctgtccagagccacagggcccctccctgctcacgctgcgggccctgcaggagttggacctcacagcctgcagcaagctgactgatgccagtttagccaaggtgctccagtttctccagctgaggcagctgtcccttagcctgttgccagaactcacagacaacggcttggttgctgtggccaggggctgtcctagcctggagcacttggcgctgagtcactgcagccgactcagtgacaagggctgggcccaggcagccagctcctggccaaggctgcagcatctcaacctgtccagctgcagtcagctcatagagcagacactggatgctattgggcaggcgtgcaggcagctccgggtgttggatgtggccacgtgccctggcatcaacatggccgccgtcagacgcttccaagcccagctgccccaggtgtcctgtgtccagtcccgcttcgtgggaggggctgacctgaccctaacactctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - WD repeat and SOCS box-containing 1 - fibroblast activation protein, alpha - retinol binding protein 5, cellular - ribosomal protein S2 pseudogene |