Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DUSP22-dual specificity phosphatase 22 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DUSP22-dual specificity phosphatase 22 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022847 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DUSP22 |
| Origin species: | Human |
| Product name: | DUSP22-dual specificity phosphatase 22 Gene |
| Size: | 2ug |
| Accessions: | BC022847 |
| Gene id: | 56940 |
| Gene description: | dual specificity phosphatase 22 |
| Synonyms: | JKAP; JSP-1; JSP1; LMW-DSP2; LMWDSP2; MKP-x; MKPX; VHX; dual specificity protein phosphatase 22; JNK-stimulating phosphatase 1; JNK-stimulatory phosphatase-1; MAP kinase phosphatase x; homolog of mouse dual specificity phosphatase LMW-DSP2; low molecular weight dual specificity phosphatase 2; mitogen-activated protein kinase phosphatase x; dual specificity phosphatase 22 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaatgggatgaacaagatcctgcccggcctgtacatcggcaacttcaaagatgccagagacgcggaacaattgagcaagaacaaggtgacacatattctgtctgtccatgatagtgccaggcctatgttggagggagttaaatacctgtgcatcccagcagcggattcaccatctcaaaacctgacaagacatttcaaagaaagtattaaattcattcacgagtgccggctccgcggtgagagctgccttgtacactgcctggccggggtctccaggagcgtgacactggtgatcgcatacatcatgaccgtcactgactttggctgggaggatgccctgcacaccgtgcgtgctgggagatcctgtgccaaccccaacgtgggcttccagagacagctccaggagtttgagaagcatgaggtccatcagtatcggcagtggctgaaggaagaatatggagagagccctttgcaggatgcagaagaagccaaaaacattctggccgctccaggaattctgaagttctgggcctttctcagaagactgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - thioredoxin domain containing 9 - hypothetical protein FLJ20433 - ELMO/CED-12 domain containing 3 - lysophosphatidic acid receptor 5 |