Cart 53 Product Products 8 034,66 € (empty)
-
1 x CALML5-cal...113,40 € -
1 x NCR3-natur...113,40 € -
1 x GSTM2-glut...113,40 € -
-
1 x LRRC8D-leu...113,40 € -
1 x DPH5-DPH5...113,40 € -
1 x WIBG-withi...113,40 € -
1 x DEFB134-de...113,40 € -
-
-
1 x IHPK2-inos...113,40 € -
1 x IFRD1-inte...121,50 € -
1 x CHRNB3-cho...121,50 € -
1 x NTF3-neuro...113,40 € -
1 x PNPLA3-pat...113,40 € -
1 x TOX2-TOX...121,50 € -
-
-
-
1 x WNK1-WNK...121,50 € -
1 x KDELR3-KDE...113,40 € -
1 x PACSIN1-pr...121,50 € -
1 x LXN-latexi...113,40 € -
1 x LOC728395-...113,40 € -
1 x MOGAT3-mon...121,50 € -
1 x Cell-Clock...409,00 € -
1 x SFXN1-side...113,40 € -
1 x FAM172A-fa...121,50 € -
1 x CYTL1-cyto...113,40 € -
1 x GTF2E2-gen...121,50 € -
1 x WDR77-WD...121,50 € -
-
1 x CYB5B-cyto...113,40 € -
1 x CYP3A43-cy...121,50 € -
-
-
-
-
1 x SIRT7-sirt...121,50 € -
-
1 x TRIM17-tri...121,50 € -
1 x ANKRD45-an...121,50 € -
1 x Insulin R...259,07 € -
1 x Olfactory...259,07 € -
-
1 x ZCWPW1-zin...121,50 € -
1 x ANKRD54-an...121,50 € -
-
-
1 x CYTH3-cyto...121,50 € -
1 x DGCR14-DiG...121,50 € -
1 x RDH13-reti...113,40 € -
1 x LOC338588-...113,40 €
No products
To be determined Shipping
8 034,66 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 53 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 8 034,66 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 8 034,66 €
View larger 
Data sheet of PTP4A1-protein tyrosine phosphatase type IVA, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTP4A1-protein tyrosine phosphatase type IVA, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC023975 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTP4A1 |
| Origin species: | Human |
| Product name: | PTP4A1-protein tyrosine phosphatase type IVA, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC023975 |
| Gene id: | 7803 |
| Gene description: | protein tyrosine phosphatase type IVA, member 1 |
| Synonyms: | HH72; PRL-1; PRL1; PTP(CAAX1); PTPCAAX1; protein tyrosine phosphatase type IVA 1; protein tyrosine phosphatase type IVA protein 1; protein-tyrosine phosphatase 4a1; protein-tyrosine phosphatase of regenerating liver 1; protein tyrosine phosphatase type IVA, member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcgaatgaaccgcccagctcctgtggaagtcacatacaagaacatgagatttcttattacacacaatccaaccaatgcgaccttaaacaaatttatagaggaacttaagaagtatggagttaccacaatagtaagagtatgtgaagcaacttatgacactactcttgtggagaaagaaggtatccatgttcttgattggccttttgatgatggtgcaccaccatccaaccagattgttgatgactggttaagtcttgtgaaaattaagtttcgtgaagaacctggttgttgtattgctgttcattgcgttgcaggccttgggagagctccagtacttgttgccctagcattaattgaaggtggaatgaaatacgaagatgcagtacaattcataagacaaaagcggcgtggagcttttaacagcaagcaacttctgtatttggagaagtatcgtcctaaaatgcggctgcgtttcaaagattccaacggtcatagaaacaactgttgcattcaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - centrosome and spindle pole associated protein 1 - fibronectin leucine rich transmembrane protein 3 - FXYD domain containing ion transport regulator 4 - CDC42 effector protein (Rho GTPase binding) 2 |