Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TAX1BP3-Tax1 (human T-cell leukemia virus type I) binding protein 3 Gene
PTXBC023980
New product
Data sheet of TAX1BP3-Tax1 (human T-cell leukemia virus type I) binding protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TAX1BP3-Tax1 (human T-cell leukemia virus type I) binding protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC023980 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TAX1BP3 |
| Origin species: | Human |
| Product name: | TAX1BP3-Tax1 (human T-cell leukemia virus type I) binding protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC023980 |
| Gene id: | 30851 |
| Gene description: | Tax1 (human T-cell leukemia virus type I) binding protein 3 |
| Synonyms: | TIP-1; TIP1; tax1-binding protein 3; Tax interaction protein 1; Tax1 (human T-cell leukemia virus type I) binding protein 3; glutaminase-interacting protein 3; tax-interacting protein 1; Tax1 binding protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcctacatcccgggccagccggtcaccgccgtggtgcaaagagttgaaattcacaagctgcgtcaaggtgagaacttaatcctgggtttcagcattggaggtggaatcgaccaggacccttcccagaatcccttctctgaagacaagacggacaagggtatttatgtcacacgggtgtctgaaggaggccctgctgaaatcgctgggctgcagattggagacaagatcatgcaggtgaacggctgggacatgaccatggtcacacacgaccaggcccgcaagcggctcaccaagcgctcggaggaggtggtgcgtctgctggtgacgcggcagtcgctgcagaaggccgtgcagcagtccatgctgtcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1 - killer cell immunoglobulin-like receptor, three domains, X1 - ADAM metallopeptidase with thrombospondin type 1 motif, 12 - protein kinase, AMP-activated, gamma 2 non-catalytic subunit |