Cart 4 Product Products 1 235,75 € (empty)
-
-
1 x ANKHD1-ank...121,50 € -
1 x ABI2-abl...121,50 € -
No products
To be determined Shipping
1 235,75 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 235,75 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 235,75 €
View larger 
Data sheet of IFI30-interferon, gamma-inducible protein 30 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IFI30-interferon, gamma-inducible protein 30 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021136 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IFI30 |
| Origin species: | Human |
| Product name: | IFI30-interferon, gamma-inducible protein 30 Gene |
| Size: | 2ug |
| Accessions: | BC021136 |
| Gene id: | 10437 |
| Gene description: | interferon, gamma-inducible protein 30 |
| Synonyms: | IFI30, lysosomal thiol reductase; IFI-30; IP-30; IP30; gamma-interferon-inducible lysosomal thiol reductase; gamma-interferon-inducible protein IP-30; interferon gamma-inducible protein 30 preproprotein; interferon, gamma-inducible protein 30; legumaturain |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccctgtcgccacttctgctgttcctgccaccgctgctgctgctgctggacgtccccacggcggcggtgcaggcgtcccctctgcaagcgttagacttctttgggaatgggccaccagttaactacaagacaggcaatctatacctgcgggggcccctgaagaagtccaatgcaccgcttgtcaatgtgaccctctactatgaagcactgtgcggtggctgccgagccttcctgatccgggagctcttcccaacatggctgttggtcatggagatcctcaatgtcacgctggtgccctacggaaacgcacaggaacaaaatgtcagtggcaggtgggagttcaagtgccagcatggagaagaggagtgcaaattcaacaaggtggaggcctgcgtgttggatgaacttgacatggagctagccttcctgaccattgtctgcatggaagagtttgaggacatggagagaagtctgccactatgcctgcagctctacgccccagggctgtcgccagacactatcatggagtgtgcaatgggggaccgcggcatgcagctcatgcacgccaacgcccagcggacagatgctctccagccaccacacgagtatgtgccctgggtcaccgtcaatgggaaacccttggaagatcagacccagctccttacccttgtctgccagttgtaccagggcaagaagccggatgtctgcccttcctcaaccagctccctcaggagtgtttgcttcaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 19 open reading frame 23 - chromosome 6 open reading frame 136 - immunoglobulin lambda variable 2-14 - microsomal glutathione S-transferase 2 |