Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TNNI2-troponin I type 2 (skeletal, fast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNNI2-troponin I type 2 (skeletal, fast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032148 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNNI2 |
| Origin species: | Human |
| Product name: | TNNI2-troponin I type 2 (skeletal, fast) Gene |
| Size: | 2ug |
| Accessions: | BC032148 |
| Gene id: | 7136 |
| Gene description: | troponin I type 2 (skeletal, fast) |
| Synonyms: | AMCD2B; DA2B; FSSV; fsTnI; troponin I, fast skeletal muscle; troponin I fast twitch 2; troponin I type 2 (skeletal, fast); troponin I, fast-twitch isoform; troponin I, fast-twitch skeletal muscle isoform; troponin I, skeletal, fast; troponin I2, fast skeletal type |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggagatgaggagaagcggaacagggccatcacggcccgcaggcagcacctgaagagcgtgatgctgcagatagcggccacggagctggagaaggaggagagccgccgtgaggcagagaagcagaactacctggcggagcactgcccgccgctgcatatcccgggctccatgtctgaagtgcaggagctctgcaaacagctgcacgccaagatcgatgcggctgaagaggagaagtacgacatggaggtgagggtgcagaagaccagcaaggagctggaggacatgaaccagaagctatttgatctgcggggcaagttcaagcggcccccactgcggagggtgcgcatgtcggccgatgccatgctcaaggccctgctgggctcgaagcacaaggtgtgcatggacctgagggccaacctgaagcaggtcaagaaggaggacacagagaaggagcgggacctgcgagacgtgggtgactggaggaagaacatcgaggagaagtctggcatggagggccggaagaagatgtttgagtccgagtcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine rich repeat containing 29 - WD repeat and SOCS box-containing 1 - fibroblast activation protein, alpha - retinol binding protein 5, cellular |