Cart 4 Product Products 477,90 € (empty)
-
1 x ANKRD44-an...121,50 € -
1 x MOBP-myeli...113,40 € -
1 x CYTIP-cyto...121,50 € -
1 x C19orf47-c...121,50 €
No products
To be determined Shipping
477,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 477,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 477,90 €
Data sheet of LAGE3-L antigen family, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LAGE3-L antigen family, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015744 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LAGE3 |
| Origin species: | Human |
| Product name: | LAGE3-L antigen family, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC015744 |
| Gene id: | 8270 |
| Gene description: | L antigen family, member 3 |
| Synonyms: | EKC/KEOPS complex subunit LAGE3; CVG5; DXS9879E; DXS9951E; ESO3; ITBA2; Pcc1; protein ESO-3; L antigen family member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgggacgcggatgcagacgcaggcggaggcgctgacggcggggatggccggggtggccacagctgccgcgggggcgtggacacagccgcagctccggccggtggagctcccccagcgcacgcgccaggtccgggcagagacgccgcgtctgcggccagggggtcacgaatgcggccgcacatattcaccctcagcgtgcctttcccgacccccttggaggcggaaatcgcccatgggtccctggcaccagatgccgagccccaccaaagggtggttgggaaggatctcacagtgagtggcaggatcctggtcgtccgctggaaagctgaagactgtcgcctgctccgaatttccgtcatcaactttcttgaccagctttccctggtggtgcggaccatgcagcgctttgggccccccgtttcccgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding motif protein 4 - RNA binding motif protein 9 - acid phosphatase 1, soluble - phospholipid scramblase 1 |