No products
Prices are tax excluded
PTXBC030059
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC030059 |
Product type: | DNA & cDNA |
Ncbi symbol: | RGS5 |
Origin species: | Human |
Product name: | RGS5-regulator of G-protein signaling 5 Gene |
Size: | 2ug |
Accessions: | BC030059 |
Gene id: | 8490 |
Gene description: | regulator of G-protein signaling 5 |
Synonyms: | MST092; MST106; MST129; MSTP032; MSTP092; MSTP106; MSTP129; regulator of G-protein signaling 5 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgtgcaaaggacttgcagctttgccccactcatgcctggaaagggccaaggagattaagatcaagttgggaattctcctccagaagccagactcagttggtgaccttgtcattccgtacaatgagaagccagagaaaccagccaagacccagaaaacctcgctggacgaggccctgcagtggcgtgattccctggacaaactcctgcagaacaactatggacttgccagtttcaaaagtttcctgaagtctgaattcagtgaggaaaaccttgagttctggattgcctgtgaggattacaagaagatcaagtcccctgccaagatggctgagaaggcaaagcaaatttatgaagaattcattcaaacggaggctcctaaagaggtgaatattgaccacttcactaaggacatcacaatgaagaacctggtggaaccttccctgagcagctttgacatggcccagaaaagaatccatgccctgatggaaaaggattctctgcctcgctttgtgcgctctgagttttatcaggagttaatcaagtag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - RAB20, member RAS oncogene family - 4-hydroxyphenylpyruvate dioxygenase - GTP-binding protein 8 (putative) - GTP binding protein 5 (putative) |