Cart 3 Product Products 342,04 € (empty)
-
-
1 x IGF2-insul...113,40 € -
1 x HDGFRP3-he...113,40 €
No products
To be determined Shipping
342,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 342,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 342,04 €
View larger 
LSM7-LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
PTXBC018621
New product
Data sheet of LSM7-LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LSM7-LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018621 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LSM7 |
| Origin species: | Human |
| Product name: | LSM7-LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC018621 |
| Gene id: | 51690 |
| Gene description: | LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
| Synonyms: | LSM7 homolog, U6 small nuclear RNA and mRNA degradation associated; LSM7 homolog, U6 small nuclear RNA associated; LSM7 U6 small nuclear RNA and mRNA degradation associated; U6 snRNA-associated Sm-like protein LSm7; YNL147W |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggataaggagaagaagaaaaaggagagcatcttggacttgtccaagtacatcgacaagacgatccgggtaaagttccagggaggccgcgaagccagtggaatcctgaagggcttcgacccactcctcaaccttgtgctggacggcaccattgagtacatgcgagaccctgacgaccagtacaagctcacggaggacacccggcagctgggcctcgtggtgtgccggggcacgtccgtggtgctaatctgcccgcaggacggcatggaggccatccccaaccccttcatccagcagcaggacgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - general transcription factor IIE, polypeptide 2, beta 34kDa - XK, Kell blood group complex subunit-related family, member 6 - sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) - eukaryotic translation initiation factor 4E family member 2 |