Cart 1 Product Products 121,50 € (empty)
-
1 x PLEKHO1-pl...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of MRPS16-mitochondrial ribosomal protein S16 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPS16-mitochondrial ribosomal protein S16 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021106 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPS16 |
| Origin species: | Human |
| Product name: | MRPS16-mitochondrial ribosomal protein S16 Gene |
| Size: | 2ug |
| Accessions: | BC021106 |
| Gene id: | 51021 |
| Gene description: | mitochondrial ribosomal protein S16 |
| Synonyms: | CGI-132; COXPD2; MRP-S16; RPMS16; 28S ribosomal protein S16, mitochondrial; S16mt; mitochondrial ribosomal protein S16 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtccacctcactactctcctctgcaaggcctaccgtgggggccacttaaccatccgccttgccctgggtggctgcaccaatcggccgttctaccgcattgtggctgctcacaacaagtgtcccagggatggccgtttcgtagagcagctgggctcctatgatccattgcccaacagtcatggagaaaaactcgttgccctcaacctagacaggatccgtcattggattggctgcggggcccacctctctaagcctatggaaaagcttctgggtcttgctggctttttccctctgcatcctatgatgatcacaaatgctgagagactgcgaaggaaacgggcacgtgaagtcctgttagcttctcagaaaacagatgcagaagctacagatacagaggctacagaaacataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 1 open reading frame 21 - immunoglobulin lambda variable 4-3 - mitochondrial ribosomal protein L23 - chromosome X open reading frame 56 |