Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CYP4A11-cytochrome P450, family 4, subfamily A, polypeptide 11 Gene
PTXBC022851
New product
Data sheet of CYP4A11-cytochrome P450, family 4, subfamily A, polypeptide 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYP4A11-cytochrome P450, family 4, subfamily A, polypeptide 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022851 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYP4A11 |
| Origin species: | Human |
| Product name: | CYP4A11-cytochrome P450, family 4, subfamily A, polypeptide 11 Gene |
| Size: | 2ug |
| Accessions: | BC022851 |
| Gene id: | 1579 |
| Gene description: | cytochrome P450, family 4, subfamily A, polypeptide 11 |
| Synonyms: | CP4Y; CYP4A2; CYP4AII; cytochrome P450 4A11; 20-HETE synthase; 20-hydroxyeicosatetraenoic acid synthase; CYPIVA11; P450HL-omega; alkane-1 monooxygenase; cytochrome P-450HK-omega; cytochrome P450, family 4, subfamily A, polypeptide 11; cytochrome P450, subfamily IVA, polypeptide 11; cytochrome P450HL-omega; fatty acid omega-hydroxylase; lauric acid omega-hydroxylase; long-chain fatty acid omega-monooxygenase; cytochrome P450 family 4 subfamily A member 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgtctctgtgctgagccccagcagactcctgggtgatgtctctggaatcctccaagcggcctccctgctcattctgcttctgctgctgatcaaggcagttcagctctacctgcacaggcagtggctgctcaaagccctccagcagttcccgtgccctccctcccactggctcttcgggcacatccaggagctccaacaggaccaggagctacaacggattcagaaatgggtggagacattcccaagtgcctgtcctcattggctatggggaggcaaagttcgtgtccagctctatgaccctgactatatgaaggtgattctggggagatcagacccgaaatcccatggttcctacagattcctggctccatggattgggtacggcttgctcctgttgaatgggcagacatggttccagcatcgacggatgctgaccccagccttccactatgacatcctgaagccctatgtggggctcatggcagactctgtacgagtgatgctggacaaatgggaagagctccttggccaggattcccctctggaggtctttcagcacgtctccttgatgaccctggacaccatcatgaagtgtgccttcaggcattggcagagagctcagcactcccgtcaccttccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vitamin K epoxide reductase complex, subunit 1-like 1 - ATP synthase mitochondrial F1 complex assembly factor 2 - transmembrane protein 8 (five membrane-spanning domains) - protein kinase (cAMP-dependent, catalytic) inhibitor beta |