PTXBC028672
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC028672 |
Product type: | DNA & cDNA |
Ncbi symbol: | C15orf15 |
Origin species: | Human |
Product name: | C15orf15-chromosome 15 open reading frame 15 Gene |
Size: | 2ug |
Accessions: | BC028672 |
Gene id: | 51187 |
Gene description: | chromosome 15 open reading frame 15 |
Synonyms: | C15orf15; HRP-L30-iso; L30; RLP24; RPL24; RPL24L; TVAS3; 60S ribosomal protein L30 isolog; homolog of yeast ribosomal like protein 24; my024 protein; ribosomal L24 domain-containing protein 1; ribosomal L24 domain containing 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcgtatcgaaaagtgttatttctgttcggggcccatctatcctggacacggcatgatgttcgtccgcaacgattgcaaggtgttcagattttgcaaatctaaatgtcataaaaactttaaaaagaagcgcgatcctcgcaaagttaggtggaccaaagcattccggaaagcagctggtaaagagcttacagtggataattcatttgaatttgaaaaacgtagaaatgaacctatcaaataccagcgagagctatggaataaaactattgatgcgatgaagagagttgaagaaatcaaacagaagcgccaagctaaatttataatgaacagattgaagaaaaataaagagctacagaaagttcaggatatcaaagaagtcaagcaaaacatccatcttatccgagcccctcttgcaggcaaagggaaacagttgggagagaaaatggtacagcagttacaagaggatgtggacatggaagatgctccttaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - family with sequence similarity 122B - chromosome 18 open reading frame 21 - chorionic gonadotropin, beta polypeptide - immunoglobulin lambda variable 3-25 |