PTXBC017981
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC017981 |
Product type: | DNA & cDNA |
Ncbi symbol: | C8orf22 |
Origin species: | Human |
Product name: | C8orf22-chromosome 8 open reading frame 22 Gene |
Size: | 2ug |
Accessions: | BC017981 |
Gene id: | 492307 |
Gene description: | chromosome 8 open reading frame 22 |
Synonyms: | pancreatic progenitor cell differentiation and proliferation factor-like protein; exocrine differentiation and proliferation factor-like protein; chromosome 8 open reading frame 22 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcatccgtaccttccattggttgccttctagccagaaatcagtattatcgaaagtccagtgtttcttcagttagttctttaactagctctgattctgttaacttcatagatgacgacaaaccacagcaagggttgcctgaagtggcagaatccacctggtggtttaaatcgtttttccattctgaacctgtgctttcaaatgtgagaataaaagatctgtctgctactggcatgaacagttga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - solute carrier family 44, member 3 - similar to RIKEN cDNA 2310008M10 - chromosome 5 open reading frame 32 - mitochondrial ribosomal protein S16 |