Cart 34 Product Products 4 702,18 € (empty)
-
1 x RGS1...259,07 € -
1 x FAM163A-fa...113,40 € -
1 x TMPO-thymo...121,50 € -
1 x RASSF8-Ras...121,50 € -
-
1 x TSPAN12-te...121,50 € -
1 x PFDN2-pref...113,40 € -
1 x GPR52-G...121,50 € -
1 x CTSG-cathe...113,40 € -
-
1 x RPL7L1-rib...113,40 € -
1 x SLP-76...259,07 € -
1 x COX11-COX1...121,50 € -
1 x C12orf10-c...121,50 € -
1 x VDAC3-volt...121,50 € -
1 x Septin 2...259,07 € -
-
-
1 x PLD4-phosp...121,50 € -
1 x CXCL13-che...113,40 € -
1 x COL20A1-co...113,40 € -
1 x LRRC14-leu...121,50 € -
1 x PPAP2B-pho...121,50 € -
1 x MXD3-MAX...113,40 € -
1 x VASP-vasod...121,50 € -
-
-
-
1 x C9orf61-ch...121,50 € -
-
1 x NIPSNAP3A-...113,40 € -
1 x FICD-FIC...121,50 € -
1 x KDELR3-KDE...113,40 € -
1 x TMEM30A-tr...121,50 €
No products
To be determined Shipping
4 702,18 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 34 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 702,18 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 702,18 €
Data sheet of VANGL1-vang-like 1 (van gogh, Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VANGL1-vang-like 1 (van gogh, Drosophila) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC065272 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VANGL1 |
| Origin species: | Human |
| Product name: | VANGL1-vang-like 1 (van gogh, Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC065272 |
| Gene id: | 81839 |
| Gene description: | vang-like 1 (van gogh, Drosophila) |
| Synonyms: | KITENIN; LPP2; STB2; STBM2; vang-like protein 1; KAI1 C-terminal interacting tetraspanin; loop-tail protein 2 homolog; strabismus 2; van Gogh-like protein 1; vang-like 1 (van gogh, Drosophila); VANGL planar cell polarity protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggataccgaatccacttattctggatattcttactattcaagtcattcgaaaaaatctcacagacaaggggaaagaactagagagagacacaagtcaccccggaataaagacggcagagggtcagaaaagtctgtcaccattcaacctcccactggagagcccctgttgggaaatgattctactcggacagaggaagttcaggatgacaactggggagagaccaccacggccatcacaggcacctcggagcacagcatatcccaagaggacattgccaggatcagcaaggacatggaggacagcgtggggctggattgcaaacgctacctgggcctcaccgtcgcctcttttcttggacttctagttttcctcacccctattgccttcatccttttacctccgatcctgtggagggatgagctggagccttgtggcacaatttgtgaggggctctttatctccatggcattcaaactcctcattctgctcatagggacctgggcactttttttccgcaagcggagagctgacatgccacgggtgtttgtgtttcgtgcccttttgttggtcctcatctttctctttgtggtttcctattggcttttttacggggtccgcattttggactctcgggaccggaattaccagggcattgtgcaatatgcagtctcccttgtggatgccctcctcttcatccattacctggccatcgtcctgctggagctcaggcagctgcagcccatgttcacgctgcaggtggtccgctccaccgatggcgagtcccgcttctacagcctgggacacctgagtatccagcgagcagcattggtggtcctagaaaattactacaaagatttcaccatctataacccaaacctcctaacagcctccaaattccgagcagccaagcatatggccgggctgaaagtctacaatgtagatggccccagtaacaatgccactggccagtcccgggccatgattgctgcagctgctcggcgcagggactcaagccacaacgagttgtattatgaagaggccgaacatgaacggcgagtaaagaagcggaaagcaaggctggtggttgcagtggaagaggccttcatccacattcagcgtctccaggctgaggagcagcagaaagccccaggggaggtgatggaccctagggaggccgcccaggccattttcccctccatggccagggctctccagaagtacctgcgcatcacccggcagcagaactaccacagcatggagagcatcctgcagcacctggccttctgcatcaccaacggcatgacccccaaggccttcctagaacggtacctcagtgcgggccccaccctgcaatatgacaaggaccgctggctctctacacagtggaggcttgtcagtgatgaggctgtgactaatggattacgggatggaattgtgttcgtccttaagtgcttggacttcagcctcgtagtcaatgtgaagaaaattccattcatcatactctctgaagagttcatagaccccaaatctcacaaatttgtccttcgcttacagtctgagacatccgtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil domain containing 28B - immunoglobulin kappa variable 1-5 - paroxysmal nonkinesigenic dyskinesia - coiled-coil domain containing 124 |