Cart 14 Product Products 1 777,57 € (empty)
-
1 x RP4-662A9....113,40 € -
1 x WDR21A-WD...121,50 € -
1 x PELI3-pell...121,50 € -
1 x POU2AF1-PO...113,40 € -
-
1 x IL11RA-int...121,50 € -
1 x GUCA1A-gua...113,40 € -
1 x BDH1-3-hyd...121,50 € -
1 x IGKV1-5-im...113,40 € -
1 x EMID2-EMI...121,50 € -
1 x IFIT5-inte...121,50 € -
1 x SH3BP5L-SH...121,50 € -
1 x SLC12A7-so...121,50 € -
1 x TPM1-tropo...121,50 €
No products
To be determined Shipping
1 777,57 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 14 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 777,57 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 777,57 €
View larger 
SLC22A12-solute carrier family 22 (organic anion/urate transporter), member 12 Gene
PTXBC053348
New product
Data sheet of SLC22A12-solute carrier family 22 (organic anion/urate transporter), member 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC22A12-solute carrier family 22 (organic anion/urate transporter), member 12 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC053348 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC22A12 |
| Origin species: | Human |
| Product name: | SLC22A12-solute carrier family 22 (organic anion/urate transporter), member 12 Gene |
| Size: | 2ug |
| Accessions: | BC053348 |
| Gene id: | 116085 |
| Gene description: | solute carrier family 22 (organic anion/urate transporter), member 12 |
| Synonyms: | OAT4L; RST; URAT1; solute carrier family 22 member 12; organic anion transporter 4-like protein; renal-specific transporter; solute carrier family 22 (organic anion/cation transporter), member 12; solute carrier family 22 (organic anion/urate transporter), member 12; urate anion exchanger 1; urate transporter 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcattttctgaactcctggacctcgtgggtggcctgggcaggttccaggttctccagacgatggctctgatggtctccatcatgtggctgtgtacccagagcatgctggagaacttctcggccgccgtgcccagccaccgctgctgggcacccctcctggacaacagcacggctcaggccagcatcctagggagcttgagtcctgaggccctcctggctatttccatcccgccgggccccaaccagaggccccatcagtgccgccgcttccgccagccacagtggcagctcttggaccccaatgccacggccaccagctggagcgaggccgacacggagccgtgtgtggatggctgggtctatgaccgcagcatcttcacctccacaatcgtggccaagtggaacctcgtgtgtgactctcacgctctgaagcccatggcccagtccatctacctggctgggattctggtgggagctgctgcgtgcggccctgcctcagacaggtttgggcgcaggctggtgctaacctggagctaccttcagatggctgtgatgggtacggcagctgccttcgcccctgccttccccgtgtactgcctgttccgcttcctgttggcctttgccgtggcaggcgtcatgatgaacacgggcactctcctgatggagtggacggcggcacgggcccgacccttggtgatgaccttgaactctctgggcttcagcttcggccatggcctgacagctgcagtggcctacggtgtgcgggactggacactgctgcagctggtggtctcggtccccttcttcctctgctttttgtactcctggtggctggcagagtcggcacgatggctcctcaccacaggcaggctggattggggcctgcaggagctgtggagggtggctgccatcaacggaaagggggcagtgcaggacaccctgacccctgaggtcttgctttcagccatgcgggaggagctgagcatgggccagcctcctgccagcctgggcaccctgctccgcatgcccggactgcgcttccggacctgtatctccacgttgtgctggttcgcctttggcttcaccttcttcggcctggccctggacctgcaggccctgggcagcaacatcttcctgctccaaatgttcattggtgtcgtggacatcccagccaagatgggcgccctgctgctgctgagccacctgggccgccgccccacgctggccgcatccctgttgctggcggggctctgcattctggccaacacgctggtgccccacgaaatgggggctctgcgctcagccttggccgtgctggggctgggcggggtgggggctgccttcacctgcatcaccatctacagcagcgagctcttccccactgtgctcaggatgacggcagtgggcttgggccagatggcagcccgtggaggagccatcctggggcctctggtccggctgctgggtgtccatggcccctggctgcccttgctggtgtatgggacggtgccagtgctgagtggcctggccgcactgcttctgcccgagacccagagcttgccgctgcccgacaccatccaagatgtgcagaaccaggcagtaaagaaggcaacacatggcacgctggggaactctgtcctaaaatccacacagttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CD74 molecule, major histocompatibility complex, class II invariant chain - solute carrier family 16, member 10 (aromatic amino acid transporter) - growth arrest and DNA-damage-inducible, gamma interacting protein 1 - solute carrier family 16, member 6 (monocarboxylic acid transporter 7) |