Cart 4 Product Products 448,31 € (empty)
-
-
1 x IL28A-inte...113,40 € -
-
1 x ORC6L-orig...113,40 €
No products
To be determined Shipping
448,31 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 448,31 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 448,31 €
View larger 
Data sheet of IL1RAP-interleukin 1 receptor accessory protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL1RAP-interleukin 1 receptor accessory protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC053621 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL1RAP |
| Origin species: | Human |
| Product name: | IL1RAP-interleukin 1 receptor accessory protein Gene |
| Size: | 2ug |
| Accessions: | BC053621 |
| Gene id: | 3556 |
| Gene description: | interleukin 1 receptor accessory protein |
| Synonyms: | C3orf13; IL-1RAcP; IL1R3; interleukin-1 receptor accessory protein; IL-1 receptor accessory protein; IL-1R3; interleukin-1 receptor 3; interleukin-1 receptor accessory protein beta; interleukin 1 receptor accessory protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacacttctgtggtgtgtagtgagtctctacttttatggaatcctgcaaagtgatgcctcagaacgctgcgatgactggggactagacaccatgaggcaaatccaagtgtttgaagatgagccagctcgcatcaagtgcccactctttgaacacttcttgaaattcaactacagcacagcccattcagctggccttactctgatctggtattggactaggcaggaccgggaccttgaggagccaattaacttccgcctccccgagaaccgcattagtaaggagaaagatgtgctgtggttccggcccactctcctcaatgacactggcaactatacctgcatgttaaggaacactacatattgcagcaaagttgcatttcccttggaagttgttcaaaaagacagctgtttcaattcccccatgaaactcccagtgcataaactgtatatagaatatggcattcagaggatcacttgtccaaatgtagatggatattttccttccagtgtcaaaccgactatcacttggtatatgggctgttataaaatacagaattttaataatgtaatacccgaaggtatgaacttgagtttcctcattgccttaatttcaaataatggaaattacacatgtgttgttacatatccagaaaatggacgtacgtttcatctcaccaggactctgactgtaaaggtagtaggctctccaaaaaatgcagtgccccctgtgatccattcacctaatgatcatgtggtctatgagaaagaaccaggagaggagctactcattccctgtacggtctattttagttttctgatggattctcgcaatgaggtttggtggaccattgatggaaaaaaacctgatgacatcactattgatgtcaccattaacgaaagtataagtcatagtagaacagaagatgaaacaagaactcagattttgagcatcaagaaagttacctctgaggatctcaagcgcagctatgtctgtcatgctagaagtgccaaaggcgaagttgccaaagcagccaaggtgaagcagaaaggtaatagatgcggtcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - natural cytotoxicity triggering receptor 1 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 - F-box and leucine-rich repeat protein 18 - elongation factor RNA polymerase II-like 3 |