PTXBC063581
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC063581 |
Product type: | DNA & cDNA |
Ncbi symbol: | ASB7 |
Origin species: | Human |
Product name: | ASB7-ankyrin repeat and SOCS box-containing 7 Gene |
Size: | 2ug |
Accessions: | BC063581 |
Gene id: | 140460 |
Gene description: | ankyrin repeat and SOCS box-containing 7 |
Synonyms: | ankyrin repeat and SOCS box protein 7; ASB-7; ankyrin repeat and SOCS box containing 7 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgttacaccatcattgtcgaaggaaccctgagctccaggaagagttgcagattcaggccgcggtggctgctggggatgtccacacagtgcgaaagatgctagaacaaggctattccccgaatggccgagatgcgaatggctggactctgcttcatttctctgcagcaagaggaaaggaaagatgtgttcgggtttttctagaacacggagctgatcctacagttaaagacttaatcggaggcttcacggctcttcactatgcagccatgcatggccgggcccgcattgcacgcttgatgttagaatctgaatacaggagcgacatcattaatgcaaaaagcaatgacggctggactcccctccatgtggctgcccactacggcagggactcatttgtccggctcctcctggagttcaaggctgaggttgacccactcagtgataaaggtaccacaccgcttcagctcgccattatccgagagaggtcaagctgtgtgaaaatcctcctggaccacaatgccaacatcgacattcagaatggtttcctgttgcgatacgccgtgatcaaaagcaatcactcttattgccgaatgttccttcagagaggggcagacacaaacttgggtcgcttagaagacggacagactcctttacacttatctgcccttagggatgatgtgctgtgtgcacggatgttatataattacggagcagacacgaacacacggaactatgaaggacagaccccattggctgtttcaataagtatttctggaagtagtcgaccatgtttggatttcttacaagaagtcacaagtatgtaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - methionine adenosyltransferase II, beta - Fanconi anemia, complementation group A - X-ray radiation resistance associated 1 - hypothetical protein LOC100127888 |