Cart 22 Product Products 2 547,35 € (empty)
-
1 x GRIN2C-glu...113,40 € -
1 x RPL27-ribo...113,40 € -
1 x GPX1-gluta...113,40 € -
1 x C6orf159-c...113,40 € -
1 x TNNT3-trop...113,40 € -
1 x CCDC42-coi...113,40 € -
1 x C4orf29-ch...121,50 € -
1 x CADM3-cell...121,50 € -
1 x LOC595101-...113,40 € -
1 x PRDM5-PR...113,40 € -
1 x REM2-RAS...121,50 € -
1 x KIF16B-kin...113,40 € -
1 x ACVR1C-act...121,50 € -
1 x C1orf93-ch...113,40 € -
1 x CHCHD2-coi...113,40 € -
1 x CD99L2-CD9...113,40 € -
1 x C1QTNF2-C1...121,50 € -
1 x METTL1-met...121,50 € -
1 x CSNK2A1-ca...121,50 € -
1 x NXT2-nucle...113,40 € -
1 x C1orf67-ch...121,50 € -
No products
To be determined Shipping
2 547,35 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 547,35 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 547,35 €
Data sheet of RNF115-ring finger protein 115 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNF115-ring finger protein 115 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC054049 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNF115 |
| Origin species: | Human |
| Product name: | RNF115-ring finger protein 115 Gene |
| Size: | 2ug |
| Accessions: | BC054049 |
| Gene id: | 27246 |
| Gene description: | ring finger protein 115 |
| Synonyms: | E3 ubiquitin-protein ligase RNF115; BCA2; ZNF364; rabring 7; zinc finger protein 364; ring finger protein 115 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggaggcttcggcggccggggcggactcgggcgccgctgtagccgcccaccggtttttctgccacttttgcaagggcgaggtcagccccaaactaccggaatatatatgtcccagatgtgaatcaggctttattgaagaagtgacagatgattccagttttttaggtggtggcggcagtcggatagacaataccacaacaacacattttgcagagctttggggccatttggatcacacgatgttttttcaagattttagaccctttctaagtagcagtccactggaccaagataatagagccaatgaaaggggtcaccagactcacactgacttctggggagcaagacctccacggttgccattgggtcggagatacagatctcgaggaagttctcgtcctgacagatctccagctattgaaggaatactacaacacatctttgcaggattctttgcaaattctgccattcctggatctccacaccctttttcctggagcgggatgctgcactccaaccctggggactatgcctggggtcagacagggcttgatgccattgtaacccagcttttaggacaactggaaaacacaggccctcccccagctgacaaggaaaagatcacatctcttccaacagtgacagtaactcaggaacaagttgatatgggtttagagtgtccagtatgcaaagaagattacacagttgaagaggaagtccggcagttaccttgcaatcacttctttcacagcagttgtattgtgccgtggctagaactgcatgacacatgtcctgtatgtaggaagagcttaaatggtgaggactctactcggcaaagccagagcactgaggcctctgcaagcaacagatttagcaatgacagtcagctacatgaccgatggactttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger protein 200 - AF4/FMR2 family, member 4 - zinc finger protein 558 - zinc finger protein 550 |