Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DYNC1H1-dynein, cytoplasmic 1, heavy chain 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DYNC1H1-dynein, cytoplasmic 1, heavy chain 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064521 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DYNC1H1 |
| Origin species: | Human |
| Product name: | DYNC1H1-dynein, cytoplasmic 1, heavy chain 1 Gene |
| Size: | 2ug |
| Accessions: | BC064521 |
| Gene id: | 1778 |
| Gene description: | dynein, cytoplasmic 1, heavy chain 1 |
| Synonyms: | CMT2O; DHC1; DHC1a; DNCH1; DNCL; DNECL; DYHC; Dnchc1; HL-3; SMALED1; p22; cytoplasmic dynein 1 heavy chain 1; dynein heavy chain, cytosolic; dynein, cytoplasmic, heavy polypeptide 1; dynein cytoplasmic 1 heavy chain 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcagtaaaatgctgaagatgcagatgttggaggatgaggacgacctggcctacgcagagaccgagaagaagacgaggacagactccacgtccgacgggcgccctgcctggatgcggacactgcacaccaccgcgtccaactggctgcacctcatcccccagacgctgagccacctcaagcgcaccgtggagaatatcaaggatcctttgttcaggttctttgagagagaagtgaagatgggcgcaaagctgcttcaggacgttcgccaggaccttgcagatgtcgtccaggtgtgcgaaggaaagaagaagcagaccaactacttgcgcacgctgatcaacgagctagtgaaagggatcttgcctcggagctggtcccactacacggtgcctgccggcatgaccgtcatccagtgggtgtccgacttcagcgagaggatcaaacagctgcagaacatctcactggcagctgcatctggtggcgccaaggagctaaaggtgaaggcgctcctgacgagtctcgggtggtcagcagctgtcctgggctggggtgggagtggctctggggaaaaacacagggcccaggtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 6 open reading frame 182 - chromosome 9 open reading frame 114 - hepatitis A virus cellular receptor 2 - chromosome 17 open reading frame 75 |