UBL4B-ubiquitin-like 4B Gene View larger

UBL4B-ubiquitin-like 4B Gene

PTXBC058929

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBL4B-ubiquitin-like 4B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBL4B-ubiquitin-like 4B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC058929
Product type: DNA & cDNA
Ncbi symbol: UBL4B
Origin species: Human
Product name: UBL4B-ubiquitin-like 4B Gene
Size: 2ug
Accessions: BC058929
Gene id: 164153
Gene description: ubiquitin-like 4B
Synonyms: ubiquitin-like protein 4B; ubiquitin like 4B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcctcacagtcaagctgctcctgggccagagatgcagtctgaaggtgtcagggcaagagagtgtagccacgctgaagagactggtgtccaggcggctgaaggtgcctgaggagcagcagcacctgcttttccgtggccagctcctggaggatgacaagcacctctctgactactgcattgggcccaatgcctctatcaatgtcatcatgcagcccttggagaagatggcgctaaaggaggcccaccagccgcagacccagcccctgtggcaccagctgggactggtcctagctaaacactttgaaccacaggatgccaaggccgtgctgcagctgctaaggcaggagcacgaggagcgcctgcagaagataagcctggagcacctggagcagctggcccagtacctcctggcagaggagcctcacgtggagccagctggagagagggagcttgaggcgaaggcacggcctcagagctcctgtgacatggaggagaaggaggaggcagcagctgatcagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nucleoporin 43kDa
- F-box protein 38
- androgen-induced 1
- calponin 3, acidic

Reviews

Buy UBL4B-ubiquitin-like 4B Gene now

Add to cart