SLC10A7-solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene View larger

SLC10A7-solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene

PTXBC063471

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC10A7-solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC10A7-solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC063471
Product type: DNA & cDNA
Ncbi symbol: SLC10A7
Origin species: Human
Product name: SLC10A7-solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene
Size: 2ug
Accessions: BC063471
Gene id: 84068
Gene description: solute carrier family 10 (sodium/bile acid cotransporter family), member 7
Synonyms: sodium/bile acid cotransporter 7; Na(+)/bile acid cotransporter 7; SBF-domain containing protein; solute carrier family 10 (sodium/bile acid cotransporter family), member 7; solute carrier family 10 member 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggctgctggagagaatgaggaaagactggttcatggtcggaatagtgctggcgatcgctggagctaaactggagccgtccataggggtgaatgggggaccactgaagccagaaataactgtatcctacattgctgttgcaacaatattctttaacagtggactatcattgaaaacagaggagctgaccagtgctttggtgcatctaaaactgcatctttttattcagatctttactcttgcattcttcccagcaacaatatggctttttcttcagcttttatcaatcacacccatcaacgaatggcttttaaaaggtttgcagacagtaggttgcatgcctccgcctgtgtcttctgcagtgattttaaccaaggcagttggtggaaatgaggcagctgcaatatttaattcagcctttggaagttttttggtaagtaaacatagtttaacttgtctattacaacttttgctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 10 (sodium/bile acid cotransporter family), member 1
- family with sequence similarity 19 (chemokine (C-C motif)-like), member A1
- TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa
- solute carrier family 10 (sodium/bile acid cotransporter family), member 2

Reviews

Buy SLC10A7-solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene now

Add to cart