PTXBC066364
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC066364 |
Product type: | DNA & cDNA |
Ncbi symbol: | SIN3A |
Origin species: | Human |
Product name: | SIN3A-SIN3 homolog A, transcription regulator (yeast) Gene |
Size: | 2ug |
Accessions: | BC066364 |
Gene id: | 25942 |
Gene description: | SIN3 homolog A, transcription regulator (yeast) |
Synonyms: | transcriptional regulator, SIN3A; transcriptional corepressor Sin3a; transcriptional co-repressor Sin3A; histone deacetylase complex subunit Sin3a; paired amphipathic helix protein Sin3a; WITKOS; SIN3 homolog A, transcription regulator; SIN3 transcription regulator homolog A; SIN3 transcription regulator family member A |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaagcggcgtttggatgaccaggagtcaccggtgtatgcagcccagcagcgtcggatccctggcagcacagaggcttttcctcaccagcaccgggtgcttgcccctgcccctcctgtgtatgaagcagtgtctgagaccatgcagtcagctacgggaattcagtactctgtaacacccagctaccaggtttcagccatgccacagagctccggcagtcatgggcccgctatagcagcagttcatagcagccatcatcacccaacagcggtgcagccccacggaggccaggtggtccagagtcatgctcatccagccccaccagttgcaccagtgcagggacagcagcaatttcagaggctgaaggtggtattcagctctttttcttgggtcaaaaaatttatctttagcaggaaatactggttgcagcttgttggttgtggtggtacaacttctaacctgagatactag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - family with sequence similarity 173, member B - signal recognition particle receptor, B subunit - PI-3-kinase-related kinase SMG-1 pseudogene - alpha- and gamma-adaptin-binding protein p34 |