PTXBC063443
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC063443 |
Product type: | DNA & cDNA |
Ncbi symbol: | LZIC |
Origin species: | Human |
Product name: | LZIC-leucine zipper and CTNNBIP1 domain containing Gene |
Size: | 2ug |
Accessions: | BC063443 |
Gene id: | 84328 |
Gene description: | leucine zipper and CTNNBIP1 domain containing |
Synonyms: | protein LZIC; leucine zipper and CTNNBIP1 domain-containing protein; leucine zipper and ICAT homologous domain-containing protein; leucine zipper domain and ICAT homologous domain containing; leucine zipper and CTNNBIP1 domain containing |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcttccagaggaaagacagagacaagcaaattaaagcagaatttagaagaacagttggatagactcatgcaacaattacaagatctggaggaatgcagagaggaacttgatacagatgaatatgaagaaaccaaaaaggaaactctggagcaactaagtgaatttaatgattcactaaagaaaattatgtctggaaatatgactttggtagatgaactaagtggaatgcagctggctattcaggcagctatcagccaggcctttaaaaccccagaggtcatcagattgtttgcaaagaaacaaccaggtcagcttcggacaaggttagcagagatggatagagatctgatggtaggaaagctggaaagagacctgtacactcaacagaaagtggagatactaacagctcttaggaaacttggagagaagctgactgcagatgatgaggccttcttgtcagcaaatgcaggtgctatactcagccagtttgagaaagtctctacagaccttggctctggagacaaaattcttgctctggcaagttttgaggttgaaaaaacaaaaaaatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - La ribonucleoprotein domain family, member 2 - DCP2 decapping enzyme homolog (S. cerevisiae) - La ribonucleoprotein domain family, member 4 - major histocompatibility complex, class I, F |