ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene

View larger

ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene

Reference: PTXBC061903

Condition: New product

Print

Data sheet of ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC061903
Product type:	DNA & cDNA
Ncbi symbol:	ISCU
Origin species:	Human
Product name:	ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene
Size:	2ug
Accessions:	BC061903
Gene id:	23479
Gene description:	iron-sulfur cluster scaffold homolog (E. coli)
Synonyms:	IscU iron-sulfur cluster scaffold homolog; iron-sulfur cluster assembly enzyme ISCU, mitochondrial; 2310020H20Rik; HML; ISU2; NIFU; NIFUN; hnifU; nifU-like N-terminal domain-containing protein; iron-sulfur cluster assembly enzyme
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggcggcggctggggctttccgtctgaggcgggcggcatcggctctgctgctgcggagcccccgcctgcccgcccgggagctgtcggccccggcccgactctatcacaagaaggttgttgatcattatgaaaatcctagaaacgtggggtcccttgacaagacatctaaaaatgttggaactggactggtgggggctccagcatgtggtgacgtaatgaaattacagattcaagtggatgaaaaggggaagattgtggatgctaggtttaaaacatttggctgtggttccgcaattgcctccagctcattagccactgaatgggtgaaaggaaagacggtggaggaagccttgactatcaaaaacacagatatcgccaaggagctctgccttcctcccgtgaaactgcactgctccatgctggctgaagatgcaatcaaggccgccctggctgattacaaattgaaacaagaacccaaaaaaggagaggcagagaagaaatga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- family with sequence similarity 54, member A - dehydrogenase/reductase (SDR family) member 9 - transmembrane and coiled-coil domain family 2 - tubulointerstitial nephritis antigen-like 1

Reviews

Be the first to write your review !

Buy ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene now