ZNF333-zinc finger protein 333 Gene View larger

ZNF333-zinc finger protein 333 Gene

PTXBC064571

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF333-zinc finger protein 333 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF333-zinc finger protein 333 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC064571
Product type: DNA & cDNA
Ncbi symbol: ZNF333
Origin species: Human
Product name: ZNF333-zinc finger protein 333 Gene
Size: 2ug
Accessions: BC064571
Gene id: 84449
Gene description: zinc finger protein 333
Synonyms: zinc finger protein 333
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatccgtcacctttgaggatgtggccgtggagttcatccaggagtgggcattgctggacagcgcacggaggagcctgtgcaaatacaggatgcttgaccagtgcaggaccctggcctccaggggaactccaccatgcaaacccagttgtgtctcccagctggggcaaagagcagagccaaaggcaacagaacgagggattctccgtgccacaggtgttgcctgggaatctcaacttaaacccgaagagttgccttctatgcaggatcttttggaagaagcatcctccagggacatgcaaatggggccggggctgttcctgaggatgcagctggtgccctccatagaagagagggagacaccattgactcgagaggaccggccagctctccaggagccgccttggtctctgggatgcacgctgcctctcctgtccctgctgctgccatcctgcccagagccaccgttagttctcctggactccagttctgctcctgacaggcacctgggctccaccctggacacagaggccagagggatcccttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphoserine phosphatase
- zinc finger protein 323
- ring finger protein 115
- zinc finger protein 200

Reviews

Buy ZNF333-zinc finger protein 333 Gene now

Add to cart