MRPL43-mitochondrial ribosomal protein L43 Gene View larger

MRPL43-mitochondrial ribosomal protein L43 Gene

PTXBC052639

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL43-mitochondrial ribosomal protein L43 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL43-mitochondrial ribosomal protein L43 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC052639
Product type: DNA & cDNA
Ncbi symbol: MRPL43
Origin species: Human
Product name: MRPL43-mitochondrial ribosomal protein L43 Gene
Size: 2ug
Accessions: BC052639
Gene id: 84545
Gene description: mitochondrial ribosomal protein L43
Synonyms: L43mt; MRP-L43; bMRP36a; 39S ribosomal protein L43, mitochondrial; mitochondrial ribosomal protein bMRP36a; mitochondrial ribosomal protein L43
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggcgcgcgggactccgagccgcttcttggccagcgttctccacaacggactgggtcgctatgtgcagcagctgcagcgtctgagcttcagcgtcagccgcgacggcgcctcgtctcgcggcgccagggagttcgtggagcgggaggtgatcgacttcgcccgacggaatccaggggtcgtaatatatgtaaactcgcgtccgtgctgcgtgcccagagtagtggccgaataccttaacggggctgtgcgcgaggagagcatccactgcaagtcggtcgaggagatctcgacgctggtgcagaagctggccgaccagtcgggcttggacgtgatccgcatccgcaagcccttccacaccgacaaccctagcatccagggccagtggcaccccttcaccaacaagccgaccacgttccgcgggctacgcccccgagaggttcaggatcctgccccagcccagtgcctgcttctgggggcagtgaccttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L43
- chromosome 3 open reading frame 62
- chromosome 9 open reading frame 85
- chromosome 5 open reading frame 24

Reviews

Buy MRPL43-mitochondrial ribosomal protein L43 Gene now

Add to cart