Cart 31 Product Products 4 736,74 € (empty)
-
1 x MYOG-myoge...113,40 € -
1 x HLA-DQA1-m...113,40 € -
1 x HLA-C-majo...121,50 € -
1 x TRIM65-tri...113,40 € -
1 x C12orf60-c...113,40 € -
1 x EGFL7-EGF-...121,50 € -
1 x FOSL2-FOS-...121,50 € -
1 x LY9-lympho...113,40 € -
1 x LTV1-LTV1...121,50 € -
1 x DEXI-dexam...113,40 € -
1 x C9orf41-ch...121,50 € -
1 x HLA-A-majo...121,50 € -
1 x GPR39-G...121,50 € -
1 x LOC158381-...113,40 € -
1 x MCM10-mini...121,50 € -
1 x HLA-B-majo...121,50 € -
1 x TFDP1-tran...121,50 € -
1 x PYHIN1-pyr...113,40 € -
1 x TTLL10-tub...121,50 € -
-
-
1 x ORMDL3-ORM...113,40 € -
1 x CXorf41-ch...113,40 € -
1 x C3orf36-ch...113,40 € -
-
1 x C2orf58-ch...113,40 € -
1 x RND3-Rho...113,40 € -
1 x PSMA6-prot...113,40 € -
1 x JTB-jumpin...113,40 € -
-
-
1 x C14orf172-...121,50 €
No products
To be determined Shipping
4 736,74 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 31 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 736,74 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 736,74 €
Data sheet of MRPL55-mitochondrial ribosomal protein L55 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL55-mitochondrial ribosomal protein L55 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC052806 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL55 |
| Origin species: | Human |
| Product name: | MRPL55-mitochondrial ribosomal protein L55 Gene |
| Size: | 2ug |
| Accessions: | BC052806 |
| Gene id: | 128308 |
| Gene description: | mitochondrial ribosomal protein L55 |
| Synonyms: | AAVG5835; L55nt; MRP-L55; PRO19675; 39S ribosomal protein L55, mitochondrial; L55mt; mitochondrial ribosomal protein L55 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggccgtgggcagcctgcttggccggctgaggcagagcaccgtgaaggccaccggacctgcactccgccgcctgcacacatcctcctggcgagctgacagcagcagggcctcactcactcgtgtgcaccgccaggcttatgcacgactctaccccgtgctgctggtgaagcaggatggctccaccatccacatccgctacagggagccacggcgcatgctggcgatgcccatagatctggacaccctgtctcctgaggagcgccgggccaggctgcggaagcgtgaggctcagctccagtcgaggaaggagtacgagcaggagctcagtgatgacttgcatgtggagcgctaccgacagttctggaccaggaccaagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 2 open reading frame 60 - mitochondrial ribosomal protein L43 - mitochondrial ribosomal protein L43 - chromosome 3 open reading frame 62 |