FAM122C-family with sequence similarity 122C Gene View larger

FAM122C-family with sequence similarity 122C Gene

PTXBC065225

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM122C-family with sequence similarity 122C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM122C-family with sequence similarity 122C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC065225
Product type: DNA & cDNA
Ncbi symbol: FAM122C
Origin species: Human
Product name: FAM122C-family with sequence similarity 122C Gene
Size: 2ug
Accessions: BC065225
Gene id: 159091
Gene description: family with sequence similarity 122C
Synonyms: protein FAM122C; family with sequence similarity 122C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacaggagaaaatgaaactaggtttcaagtcgctgccgagttccactaccgcagacggcaacattctgagaagagtcaacagtgcccctttgatcaatggacttggttttaattcacaggtgttgcaagctgacatgttaagaattaggacaaacagaacaacatttaggaatcgacgctctctggaattctggcacttctgctcaagccggatgtcactgcgtcacttctccatccccaccccctcctcttccaaaggaagcaggggaaatgtctcatcttcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 19 open reading frame 12
- B-cell receptor-associated protein 31
- chromosome 15 open reading frame 38
- family with sequence similarity 122C

Reviews

Buy FAM122C-family with sequence similarity 122C Gene now

Add to cart