Cart 1 Product Products 121,50 € (empty)
-
1 x CMKLR1-che...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
CMC1-COX assembly mitochondrial protein homolog (S. cerevisiae) Gene
PTXBC052644
New product
Data sheet of CMC1-COX assembly mitochondrial protein homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CMC1-COX assembly mitochondrial protein homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC052644 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CMC1 |
| Origin species: | Human |
| Product name: | CMC1-COX assembly mitochondrial protein homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC052644 |
| Gene id: | 152100 |
| Gene description: | COX assembly mitochondrial protein homolog (S. cerevisiae) |
| Synonyms: | C3orf68; COX assembly mitochondrial protein homolog; C-x(9)-C motif containing 1; COX assembly mitochondrial protein 1 homolog; CX9C mitochondrial protein required for full expression of COX 1; cmc1p; mitochondrial metallochaperone-like protein; C-X9-C motif containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgctcgaccccgcagaccagcatctcagacatgtcgaaaaagatgttttgatccctaaaataatgagagaaaaggccaaagagaggtgttctgaacaagttcaagattttaccaaatgttgcaagaactctggagttcttatggtagtaaaatgccggaaagaaaattctgcattgaaagaatgtctaactgcttactataatgatccagccttttatgaagaatgcaaaatggaatacctgaaggaaagggaagaattcagaaaaactggaattcctacaaagaaaaggctacagaagcttccaacaagcatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - alanyl-tRNA synthetase domain containing 1 pseudogene - protein kinase (cAMP-dependent, catalytic) inhibitor alpha - receptor (G protein-coupled) activity modifying protein 3 - transmembrane emp24 protein transport domain containing 6 |