Cart 19 Product Products 2 975,62 € (empty)
-
1 x RGS1...259,07 € -
1 x FAM163A-fa...113,40 € -
1 x TMPO-thymo...121,50 € -
1 x RASSF8-Ras...121,50 € -
-
1 x TSPAN12-te...121,50 € -
1 x PFDN2-pref...113,40 € -
1 x GPR52-G...121,50 € -
1 x CTSG-cathe...113,40 € -
-
1 x RPL7L1-rib...113,40 € -
1 x SLP-76...259,07 € -
1 x COX11-COX1...121,50 € -
1 x C12orf10-c...121,50 € -
1 x VDAC3-volt...121,50 € -
1 x Septin 2...259,07 € -
-
-
1 x PLD4-phosp...121,50 €
No products
To be determined Shipping
2 975,62 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 975,62 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 975,62 €
View larger 
VPS37D-vacuolar protein sorting 37 homolog D (S. cerevisiae) Gene
PTXBC064621
New product
Data sheet of VPS37D-vacuolar protein sorting 37 homolog D (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VPS37D-vacuolar protein sorting 37 homolog D (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064621 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VPS37D |
| Origin species: | Human |
| Product name: | VPS37D-vacuolar protein sorting 37 homolog D (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC064621 |
| Gene id: | 155382 |
| Gene description: | vacuolar protein sorting 37 homolog D (S. cerevisiae) |
| Synonyms: | VPS37D, ESCRT-I subunit; ESCRT-I complex subunit VPS37D; WBSCR24; vacuolar protein sorting-associated protein 37D; Williams Beuren syndrome chromosome region 24; Williams-Beuren syndrome critical region protein 24; vacuolar protein sorting 37 homolog D; vacuolar protein sorting 37D; williams-Beuren syndrome chromosomal region 24 protein; williams-Beuren syndrome region protein 24 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcatcgctggagtccccactgcgcgctgggctggctgcaggctgagctagaagaggcggagcaggaggcagaggagcagatggagcagctgctgctcggggagcaaagcctggaggccttcctgcctgccttccagcgtggccgcgccctggcccacctgaggcggacgcaggcagagaagctgcaggagctgctgcggcgtcgggagcgttctgcccagccggcccccacctcggctgctgatccccccaaatccttcccggctgcagctgtcctgcccactggggccgcccgggggccaccagcagtgccccggagcctgccccccttggactcccgcccagtgcccccactgaagggctcccccgggtgccccctcggcccggcccccctgctgagccctcggccctcgcagccagagcccccccaccggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hepatocyte growth factor (hepapoietin A; scatter factor) - pyridoxal-dependent decarboxylase domain containing 2 - proteasome (prosome, macropain) subunit, alpha type, 6 - deleted in lymphocytic leukemia 1 (non-protein coding) |