Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CROP-cisplatin resistance-associated overexpressed protein Gene
PTXBC056409
New product
Data sheet of CROP-cisplatin resistance-associated overexpressed protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CROP-cisplatin resistance-associated overexpressed protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC056409 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CROP |
| Origin species: | Human |
| Product name: | CROP-cisplatin resistance-associated overexpressed protein Gene |
| Size: | 2ug |
| Accessions: | BC056409 |
| Gene id: | 51747 |
| Gene description: | cisplatin resistance-associated overexpressed protein |
| Synonyms: | CROP; CRA; CREAP-1; LUC7A; OA48-18; hLuc7A; luc7-like protein 3; CRE-associated protein 1; LUC7-like 3; cAMP regulatory element-associated protein 1; cisplatin resistance-associated-overexpressed protein; okadaic acid-inducible phosphoprotein OA48-18; LUC7 like 3 pre-mRNA splicing factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatttcggccgcgcagttgttggatgagttaatgggccgggaccgaaacctagccccggacgagaagcgcagcaacgtgcggtgggaccacgagagcgtttgtaaatattatctctgtggtttttgtcctgcggaattgttcacaaatacacgttctgatcttgatgtatttggaagaggagataacattagtgatgtcagcaaatttttggaagatgacaagtggatggaggagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane and ubiquitin-like domain containing 2 - ST3 beta-galactoside alpha-2,3-sialyltransferase 5 - membrane-spanning 4-domains, subfamily A, member 6A - ChaC, cation transport regulator homolog 2 (E. coli) |