> >>MRPL14-mitochondrial ribosomal protein L14 Gene
MRPL14-mitochondrial ribosomal protein L14 Gene View larger

MRPL14-mitochondrial ribosomal protein L14 Gene

PTXBC065005

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of MRPL14-mitochondrial ribosomal protein L14 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL14-mitochondrial ribosomal protein L14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC065005
Product type: DNA & cDNA
Ncbi symbol: MRPL14
Origin species: Human
Product name: MRPL14-mitochondrial ribosomal protein L14 Gene
Size: 2ug
Accessions: BC065005
Gene id: 64928
Gene description: mitochondrial ribosomal protein L14
Synonyms: L14mt; L32mt; MRP-L14; MRP-L32; MRPL32; RMPL32; RPML32; 39S ribosomal protein L14, mitochondrial; 39S ribosomal protein L32, mitochondrial; mitochondrial ribosomal protein L14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctttctttactgggctctggggccccttcacctgtgtaagcagagtgctgagccatcactgtttcagcaccactgggagtctgagtgcgattcagaagatgacgcgggtacgagtggtggacaacagtgccctggggaacagcccataccatcgggctcctcgctgcatccatgtctataagaagaatggagtgggcaaggtgggcgaccagatactactggccatcaagggacagaagaaaaaggcgctcattgtggggcactgcatgcctggcccccgaatgacccccagattcgactccaacaacgtggtcctcattgaggacaacgggaaccctgtggggacacgaattaagacacccatccccaccagcctgcgcaagcgggaaggcgagtattccaaggtgctggccattgctcagaactttgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L32 pseudogene 3
- mitochondrial ribosomal protein L55
- chromosome 2 open reading frame 60
- mitochondrial ribosomal protein L43

Reviews

Buy MRPL14-mitochondrial ribosomal protein L14 Gene now

Add to cart