Cart 2 Product Products 226,80 € (empty)
-
1 x LZIC-leuci...113,40 € -
1 x SPINK4-ser...113,40 €
No products
To be determined Shipping
226,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 226,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 226,80 €
Data sheet of MGC70863-similar to RPL23AP7 protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGC70863-similar to RPL23AP7 protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC065556 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC70863 |
| Origin species: | Human |
| Product name: | MGC70863-similar to RPL23AP7 protein Gene |
| Size: | 2ug |
| Accessions: | BC065556 |
| Gene id: | 284942 |
| Gene description: | similar to RPL23AP7 protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcactcaccttcaggcggcccaagacactgcgactccggaggcagcccagatatcctcggaagagcacccccaggagaaacaagcttggccactatgctatcatcaagtttccgctggccactgagtcggccgtgaagaagatagaagaaaacaacacgcttgtgttcactgtggatgttaaagccaacaagcaccagatcagacaggctgtgaagaagctctatgacagtgatgtggccaaggtcaccaccctgatttgtcctgataaggagaacaaggcatatgttcgacttgctcctgattatgatgctttcgatgttgtaacaaaattgggatcacctaaactgagtccagctggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADAM metallopeptidase domain 2 - pellino homolog 1 (Drosophila) - roadblock domain containing 3 - jagunal homolog 1 (Drosophila) |