Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
COX6B2-cytochrome c oxidase subunit VIb polypeptide 2 (testis) Gene
PTXBC064548
New product
Data sheet of COX6B2-cytochrome c oxidase subunit VIb polypeptide 2 (testis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COX6B2-cytochrome c oxidase subunit VIb polypeptide 2 (testis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064548 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX6B2 |
| Origin species: | Human |
| Product name: | COX6B2-cytochrome c oxidase subunit VIb polypeptide 2 (testis) Gene |
| Size: | 2ug |
| Accessions: | BC064548 |
| Gene id: | 125965 |
| Gene description: | cytochrome c oxidase subunit VIb polypeptide 2 (testis) |
| Synonyms: | COXVIB2; CT59; cytochrome c oxidase subunit 6B2; COX VIb-2; cancer/testis antigen 59; cytochrome c oxidase subunit VIb polypeptide 2 (testis); cytochrome c oxidase subunit VIb, testes-specific |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttggatgtggaagcccaggagccccccaaggggaaatggtcgacgccgcccttcgacccgcgcttccccagccagaaccagatccgtaactgctaccagaacttcctggactaccaccgctgcctcaagaccaggacccgccgcgggaagagcacgcagccctgcgagtactatttccgcgtgtaccactcgctgtgccccatcagctgggtggagagctggaacgagcagatcaagaacgggattttcgccggcaaaatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitogen-activated protein kinase kinase kinase kinase 2 - cytochrome P450, family 17, subfamily A, polypeptide 1 - cytochrome P450, family 4, subfamily A, polypeptide 11 - vitamin K epoxide reductase complex, subunit 1-like 1 |