Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of AKT2-v-akt murine thymoma viral oncogene homolog 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AKT2-v-akt murine thymoma viral oncogene homolog 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063421 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AKT2 |
| Origin species: | Human |
| Product name: | AKT2-v-akt murine thymoma viral oncogene homolog 2 Gene |
| Size: | 2ug |
| Accessions: | BC063421 |
| Gene id: | 208 |
| Gene description: | v-akt murine thymoma viral oncogene homolog 2 |
| Synonyms: | HIHGHH; PKBB; PKBBETA; PRKBB; RAC-BETA; RAC-beta serine/threonine-protein kinase; PKB beta; RAC-PK-beta; murine thymoma viral (v-akt) homolog-2; protein kinase Akt-2; protein kinase B beta; rac protein kinase beta; v-akt murine thymoma viral oncogene homolog 2; AKT serine/threonine kinase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggtgtctgtcatcaaagaaggctggctccacaagcgtggtgaaatacatcaagacctggaggccacggtacttcctgctgaagagcgacggctccttcattgggtacaaggagaggcccgaggcccctgatcagactctaccccccttaaacaacttctccgtagcagaatgccagctgatgaagaccgagaggccgcgacccaacacctttgtcatacgctgcctgcagtggaccacagtcatcgagaggaccttccacgtggattctccagacgagagggaggagtggatgcgggccatccagatggtcgccaacagcctccagcctcacctttgtgcccagactcgcatttggaagactccacctcccgcccaggcctgggctgttgggcggttggagattcaggttttaatccacacaagccccagtgaggggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome c oxidase subunit 8A (ubiquitous) - cyclic AMP-regulated phosphoprotein, 21 kD - DNA (cytosine-5-)-methyltransferase 3 alpha - cold shock domain containing C2, RNA binding |