Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of BOLA1-bolA homolog 1 (E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BOLA1-bolA homolog 1 (E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063405 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BOLA1 |
| Origin species: | Human |
| Product name: | BOLA1-bolA homolog 1 (E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC063405 |
| Gene id: | 51027 |
| Gene description: | bolA homolog 1 (E. coli) |
| Synonyms: | CGI-143; bolA-like protein 1; bolA homolog 1; bolA-like 1; bolA family member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgagtgggcggctggtcctgggtctggtctccatggctggccgcgtttgtttgtgccagggcagcgcgggatccggggccatcggtccggtggaggccgccattcgcacgaagttggaggaggccctgagccccgaggtgctagagcttcgcaacgagagcggtggccacgcggtcccgcctggcagtgagactcacttccgcgtggctgtggtgagctctcgtttcgagggactgagccccctacaacgacaccggctggtccacgcagcgctggccgaggagctgggaggtccggtccatgcgctggccatccaggcacggacccccgcccagtggagagagaactctcagctggacactagccccccatgcctgggtgggaacaagaaaactctaggaaccccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phospholipase C, delta 1 - retinoic acid induced 14 - zinc finger protein 333 - phosphoserine phosphatase |