SNX20-sorting nexin 20 Gene View larger

SNX20-sorting nexin 20 Gene

PTXBC063423

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNX20-sorting nexin 20 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNX20-sorting nexin 20 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC063423
Product type: DNA & cDNA
Ncbi symbol: SNX20
Origin species: Human
Product name: SNX20-sorting nexin 20 Gene
Size: 2ug
Accessions: BC063423
Gene id: 124460
Gene description: sorting nexin 20
Synonyms: SLIC1; sorting nexin-20; selectin ligand-interactor cytoplasmic 1; sorting nexin 20
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaagtccagagcaccctgggagccctggctgcatgggacccataacccagtgcacggcaaggacccagcaggaagcaccagccactggccccgacctcctgcacccaggacctgacgggcacttagacacacacagtggcctgagctccaactccagcatgaccacgcgggagcttcagcagtactggcagaaccagaaatgccgctggaagcacgtcaaactgctctttgagatcgcttcagctcgcatcgaggagagaaaagtctctaagtttgtggctccggctcctgacgccacaccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - actinin, alpha 2
- cytidine deaminase
- chymotrypsin-like
- CDC-like kinase 2

Reviews

Buy SNX20-sorting nexin 20 Gene now

Add to cart