> >>FLJ22795-hypothetical protein FLJ22795 Gene
FLJ22795-hypothetical protein FLJ22795 Gene View larger

FLJ22795-hypothetical protein FLJ22795 Gene

PTXBC065260

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of FLJ22795-hypothetical protein FLJ22795 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLJ22795-hypothetical protein FLJ22795 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC065260
Product type: DNA & cDNA
Ncbi symbol: FLJ22795
Origin species: Human
Product name: FLJ22795-hypothetical protein FLJ22795 Gene
Size: 2ug
Accessions: BC065260
Gene id: 80154
Gene description: hypothetical protein FLJ22795
Synonyms: golgin subfamily A member 2-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgaacatcccaggggacctggagagccgggaggccatggtggcatttttcaactccgctggagccaatgcccaggaggaacaaagggtgtgctgccagcccctggctcacccagtggcctcgtcccagaaaaagccagaggtagcggccccagccccagagagtgggggtgagtctgtgtttggggagacccaccgggccctgcagggggccatggagaagctgcagcgactttatggaaggagaaggtggacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chondrosarcoma associated gene 1
- hypothetical protein LOC51233
- ubiquitin-conjugating enzyme E2O
- cerebral cavernous malformation 2

Reviews

Buy FLJ22795-hypothetical protein FLJ22795 Gene now

Add to cart