Cart 18 Product Products 2 060,57 € (empty)
-
1 x HSPB2-heat...113,40 € -
1 x KMO-kynure...121,50 € -
-
1 x PCGF6-poly...121,50 € -
-
1 x SELV-selen...121,50 € -
1 x DNAJC1-Dna...121,50 € -
1 x CHMP1A-chr...113,40 € -
-
1 x LOC152225-...113,40 € -
1 x FBXO6-F-bo...121,50 € -
1 x C21orf56-c...113,40 € -
1 x VPS29-vacu...113,40 € -
1 x SPATA4-spe...121,50 € -
-
1 x ELK1-ELK1,...121,50 € -
1 x C21orf58-c...113,40 € -
1 x P2RY5-puri...121,50 €
No products
To be determined Shipping
2 060,57 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 18 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 060,57 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 060,57 €
View larger 
TSEN54-tRNA splicing endonuclease 54 homolog (S. cerevisiae) Gene
PTXBC047793
New product
Data sheet of TSEN54-tRNA splicing endonuclease 54 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TSEN54-tRNA splicing endonuclease 54 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC047793 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TSEN54 |
| Origin species: | Human |
| Product name: | TSEN54-tRNA splicing endonuclease 54 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC047793 |
| Gene id: | 283989 |
| Gene description: | tRNA splicing endonuclease 54 homolog (S. cerevisiae) |
| Synonyms: | TSEN54 tRNA splicing endonuclease subunit; PCH2A; PCH4; PCH5; SEN54L; sen54; tRNA-splicing endonuclease subunit Sen54; SEN54 homolog; hsSen54; tRNA-intron endonuclease Sen54; tRNA splicing endonuclease subunit 54 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcccgatcccgagcccgcggccgtggaggttcccgcggggcgcgtgctcagcgcccgggagctcttcgccgcccgctcgcggtcgcagaagctgccccagcgctcgcatggccccaaggactttctgcccgacggctcggcagctcaggccgagcggctgcgccggtgccgggaagagctctggcagctgctggcagagcagcgcgtggagcgcctgggcagcttggtggctgccgagtggaggccagaagagggcttcgtggagttgaagtctcccgcgggcaaattctggcagaccatgggcttctcagagcagggccggcagcgccttcacccggaagaggccttgtatcttctggagtgtggctccatccacctcttccaccaagacctgccactgtctatccaggaagcttaccagctgctgctgaccgaccacactgtgaccttcctgcagtaccaggtcttcagccacctgaagaggttgggttatgtggttcgacgattccaaccaagctctgtcctgtccccgtatgagaggcagcttaacctggatgccagcgtgcagcacttggaggatggagatggcaagagaaagaggagcagctccagccctcggtccattaataagaaggccaaggccctggacaactccctgcaacccaagagtctggcagcctccagcccacctccctgcagccagcccagccaatgcccagaggagaaaccccaggagtcaagccccatgaagggcccagggggcccctttcagcttctggggtccctgggccccagccctggcccggccagggagggggtggggtgcagctgggagagtggcagagccgagaacggagtcacgggagccggtaagcggcgctggaacttcgagcagatctccttccccaacatggcttcagacagccgccacacccttctgcgcgccccagccccagagctgctcccggccaacgtggctgggcgggagacagacgctgagtcctggtgccagaagctgaaccagcgcaaggagaacctctccaggcgggaacgggagcaccacgcggaggccgcgcagttccaggaagatgtcaacgccgatcccgaggtgcagcgctgctccagctggcgggagtacaaggagctgctgcagcggcggcaggtgcagaggagccagcgccgggcccctcacctgtggggccagcccgtcaccccgctgctgagtcctggccaggccagctccccagccgtggtccttcagcatatctctgtgctgcagacaacacaccttcctgatggaggtgtccggctgttggagaagtctgggggcttggaaatcatctttgatgtttaccaggccgacgctgtggccacattccgaaagaataaccctggcaaaccctatgcccggatgtgcattagtggatttgatgagcctgtcccagacctctgcagcctcaagcggttgtcttaccagagtggggatgtccctctgatctttgccctggtggatcatggtgacatctccttctacagcttcagggacttcacgttgccccaggatgtggggcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vacuolar protein sorting 37 homolog D (S. cerevisiae) - hepatocyte growth factor (hepapoietin A; scatter factor) - pyridoxal-dependent decarboxylase domain containing 2 - proteasome (prosome, macropain) subunit, alpha type, 6 |