Cart 14 Product Products 1 985,90 € (empty)
-
1 x CLDN12-cla...113,40 € -
1 x IGLV6-57-i...113,40 € -
1 x PUSL1-pseu...121,50 € -
1 x MNDA-myelo...121,50 € -
1 x CD40-CD40...121,50 € -
-
-
1 x RNASE4-rib...113,40 € -
1 x TIMP1-TIMP...113,40 € -
1 x Phospho-DN...259,07 € -
-
-
1 x VAX2-ventr...121,50 € -
1 x PSAT1-phos...121,50 €
No products
To be determined Shipping
1 985,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 14 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 985,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 985,90 €
Data sheet of MEIS2-Meis homeobox 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MEIS2-Meis homeobox 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050431 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MEIS2 |
| Origin species: | Human |
| Product name: | MEIS2-Meis homeobox 2 Gene |
| Size: | 2ug |
| Accessions: | BC050431 |
| Gene id: | 4212 |
| Gene description: | Meis homeobox 2 |
| Synonyms: | TALE homeobox protein Meis2; homeobox protein Meis2; HsT18361; MRG1; Meis homolog 2; Meis1, myeloid ecotropic viral integration site 1 homolog 2; Meis1-related gene 1; meis1-related protein 1; Meis homeobox 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcaaaggtacgatgagctgccccattacggcgggatggacggagtaggggttcccgcttccatgtacggagaccctcacgcgccgcggccgatccccccggttcaccacctgaaccacgggccgccgctccacgccacacagcactacggcgcgcacgccccgcaccccaatgtcatgccggccagtatgggatccgctgtcaacgacgccttgaagcgggacaaggacgcgatctatgggcacccgttgtttcctctgttagctctggtctttgagaagtgcgagctggcgacctgcactccccgggaacctggagtggctggcggagacgtctgctcctccgactccttcaacgaggacatcgcggtcttcgccaagcaggttcgcgccgaaaagccacttttttcctcaaatccagagctggacaatttgatgatacaagcaatacaagtactaaggtttcatcttttggagttagaaaaggtccacgaactgtgcgataacttctgccaccgatacattagctgtttgaaggggaaaatgcccatcgacctcgtcattgatgaaagagacggcagctccaagtcagatcatgaagaactttcaggctcctccacaaatctcgctgaccataacccttcttcttggcgagaccacgatgatgcaacctcaacccactcagcaggcaccccagggccctccagtgggggccatgcttcccagagcggagacaacagcagtgagcaaggggatggtttagacaacagtgtagcttcacctggtacaggtgacgatgatgatccggataaggacaaaaaacgccagaagaaaagaggcattttccccaaagtagcaacaaatatcatgagagcatggctcttccagcatctcacacatccgtacccttccgaagagcagaagaaacagttagcgcaagacacaggacttacaattctccaagtaaacaactggtttattaatgccagaagaagaatagtacagcccatgattgaccagtcaaatcgagcagtgagccaaggagcagcatatagtccagagggtcagcccatggggagctttgtgttggatggtcagcaacacatggggatccggcctgcaggtttgcagagcatgccaggggactacgtttctcagggtggtcctatgggaatgagtatggcacagccaagttacactcctccccagatgaccccacaccctactcaattaagacatggacccccaatgcattcatatttgccaagccatccccaccacccagccatgatgatgcacggaggaccccctacccaccctggaatgactatgtcagcacagagccccacaatgttaaattctgtagatcccaatgttggcggacaggttatggacattcatgcccaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - F-box protein 3 - obscurin-like 1 - proline rich 19 - neurexophilin 4 |