Cart 35 Product Products 4 845,05 € (empty)
-
1 x BRI3-brain...113,40 € -
1 x SMRTe...259,07 € -
1 x TMEM66-tra...121,50 € -
1 x HAPLN1-hya...121,50 € -
1 x FGF1-fibro...113,40 € -
1 x PGF-placen...113,40 € -
1 x RCHY1-ring...113,40 € -
-
-
1 x Estrone...399,00 € -
1 x OMP-olfact...113,40 € -
1 x LRRC39-leu...121,50 € -
1 x ARHGEF16-R...121,50 € -
1 x ARFIP2-ADP...121,50 € -
1 x DEFB119-de...113,40 € -
1 x RIOK3-RIO...121,50 € -
1 x BTNL2-buty...113,40 € -
-
1 x RRP1-ribos...121,50 € -
1 x GABRA3-gam...121,50 € -
1 x RFXANK-reg...113,40 € -
1 x ERK 5...259,07 € -
-
1 x CAP2-CAP,...121,50 € -
1 x ARF3-ADP-r...113,40 € -
1 x ARF6-ADP-r...113,40 € -
1 x DDX60-DEAD...113,40 € -
1 x LOC729862-...113,40 € -
-
-
1 x IMPA2-inos...121,50 € -
1 x SNAP29-syn...113,40 € -
-
-
No products
To be determined Shipping
4 845,05 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 35 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 845,05 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 845,05 €
Data sheet of POLK-polymerase (DNA directed) kappa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLK-polymerase (DNA directed) kappa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050718 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLK |
| Origin species: | Human |
| Product name: | POLK-polymerase (DNA directed) kappa Gene |
| Size: | 2ug |
| Accessions: | BC050718 |
| Gene id: | 51426 |
| Gene description: | polymerase (DNA directed) kappa |
| Synonyms: | DINB1; DINP; POLQ; polymerase (DNA directed) kappa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatagcacaaaggagaagtgtgacagttacaaagatgatcttctgcttaggatgggacttaatgataataaagcaggaatggaaggattagataaagagaaaattaacaaaattataatggaagccacgaaggggtccagattttatggaaatgagctcaagaaagaaaagcaagtcaaccaacgaattgaaaatatgatgcaacaaaaagctcaaatcaccagccaacagctaagaaaagcacaattacaggttgacagatttgcaatggaattagaacaaagccgaaatttgagcaataccatagtgcacattgacatggatgctttctatgcagctgtagaaatgagggacaatccagaattgaaggataaacccattgctgtaggatcaatgagtatgctgtctacttcaaattaccatgcaaggagatttggtgttcgtgcagccatgccaggatttattgctaagaggctgtgcccacaacttataatagtgccccccaactttgacaaataccgagctgtgagtaaagaggttaaggaaatacttgctgattatgatcccaattttatggccatgagtcttgatgaagcctacttgaatataacaaagcacttagaagaaagacaaaattggcctgaggataaaagaaggtatttcatcaaaatgggaagctctgtagaaaatgataatccaggaaaggaagttaataaactgagtgagcatgaacgatccatctctccactactttttgaagagagtccttctgatgtgcagcccccaggagatcctttccaagtgaactttgaagaacaaaacaatcctcaaatactccaaaactcagttgtttttggaacatcagcccaggaagtggtaaaggaaattcgtttcagaattgagcagaaaacaacactgacagccagtgcaggcattgccccaaatacaatgttagcaaaagtatgcagtgataagaataaaccaaatggacaataccaaattcttcccaatagacaagctgtgatggacttcatcaaggatttacccattagaaaggtttctggaataggaaaagttacagagaaaatgttaaaggcccttggaattattacatgtacagaactttaccaacagagggcattgctttctctccttttctctgaaacatcttggcattatttccttcatatctccttgggtctaggttcaacacacctgacgagggatggagagaggaaaagtatgagcgttgagaggacattcagtgagataaataaagcggaagagcaatacagcctatgtcaagaactttgcagtgagcttgctcaggatctacagaaagaaagacttaaggtgctttattttgatatggtgtccttagtttttaagttttttaatagtaaaatgctaccttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - EFR3 homolog B (S. cerevisiae) - UDP-glucose pyrophosphorylase 2 - virus-induced signaling adapter - similar to RPL23AP7 protein |