Cart 1 Product Products 113,40 € (empty)
-
1 x JOSD1-Jose...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
RMND5A-required for meiotic nuclear division 5 homolog A (S. cerevisiae) Gene
PTXBC047668
New product
Data sheet of RMND5A-required for meiotic nuclear division 5 homolog A (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RMND5A-required for meiotic nuclear division 5 homolog A (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047668 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RMND5A |
| Origin species: | Human |
| Product name: | RMND5A-required for meiotic nuclear division 5 homolog A (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC047668 |
| Gene id: | 64795 |
| Gene description: | required for meiotic nuclear division 5 homolog A (S. cerevisiae) |
| Synonyms: | CTLH; GID2; GID2A; RMD5; p44CTLH; protein RMD5 homolog A; 44-kD protein coding for CTLH motif; C-terminal to LisH motif, 44 kDa; GID complex subunit 2 homolog A; required for meiotic nuclear division 5 homolog A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatcagtgcgtgacggtggagcgcgagctggagaaggtgctgcacaagttctcaggctacgggcagctgtgcgagcgcggcctggaggagctcatcgactacaccggcggcctcaagcacgagatcctgcagagccacggccaagatgctgaattatcagggacactttcacttgttttgacacagtgctgtaaaagaataaaggatactgttcaaaaattggcctccgaccacaaagacatccacagcagtgtttctcgggttggaaaagccattgataagaattttgattctgacattagcagtgtgggaatagatggctgctggcaggcagacagccaaaggcttctcaatgaggtgatggtggagcacttctttcgacaaggaatgctggatgtggctgaggagctctgtcaggaatctggtctttctgtagacccaagtcagaaggaaccatttgtggagttaaatagaatattagaggcattaaaggtcagagttctgagacctgctctggagtgggcagtgtcaaaccgggaaatgcttatagctcaaaacagctccttggaatttaagctacacagactgtattttattagcttgttaatgggtggaaccacaaatcagcgagaggcattacaatatgctaaaaattttcagccatttgccctaaatcatcaaaaagacattcaggttttgatgggaagccttgtgtacctgagacaagggattgagaactcaccatatgttcacctacttgatgcaaaccagtgggctgatatctgtgacatctttacacgggatgcttgtgccctcctggggctctccgtggagtcccctctcagtgtcagtttctcagcaggttgtgtggcgctgccagctttaattaacatcaaagccgtgattgaacagaggcagtgtactggagtttggaaccagaaagatgaattacctattgaagtggaccttggtaaaaagtgctggtatcactctatatttgcctgccccattcttcgtcagcaaacaacagataacaatccacccatgaaattggtctgtggtcatattatatcaagagatgccctgaataaaatgtttaatggtagcaaattaaaatgtccctactgtccaatggaacaaagtccaggagatgccaaacagatatttttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 22 (organic anion transporter), member 13 - guanine nucleotide binding protein (G protein), alpha z polypeptide - transient receptor potential cation channel, subfamily M, member 1 - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G |