Cart 19 Product Products 3 289,31 € (empty)
-
-
1 x ZBP1-Z-DNA...113,40 € -
-
1 x Prolactin-...744,00 € -
1 x RSPO3-R-sp...121,50 € -
1 x Prolactin324,00 € -
1 x MAPKAP1-mi...121,50 € -
1 x RAB40AL-RA...121,50 € -
1 x C20orf141-...113,40 € -
1 x CABYR-calc...121,50 € -
1 x NXNL2-nucl...113,40 € -
-
1 x PAX3-paire...121,50 € -
-
1 x CSF2-colon...113,40 € -
1 x SLC35E2-so...121,50 € -
-
-
1 x DKKL1-dick...113,40 €
No products
To be determined Shipping
3 289,31 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 289,31 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 289,31 €
Data sheet of QPCT-glutaminyl-peptide cyclotransferase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about QPCT-glutaminyl-peptide cyclotransferase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047756 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | QPCT |
| Origin species: | Human |
| Product name: | QPCT-glutaminyl-peptide cyclotransferase Gene |
| Size: | 2ug |
| Accessions: | BC047756 |
| Gene id: | 25797 |
| Gene description: | glutaminyl-peptide cyclotransferase |
| Synonyms: | GCT; sQC; glutaminyl-peptide cyclotransferase; glutaminyl-tRNA cyclotransferase; glutamyl cyclase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggcggaagacaccggcgcgtcgtgggcaccctccacctgctgctgctggtggccgccctgccctgggcatccaggggggtcagtccgagtgcctcagcctggccagaggagaagaattaccaccagccagccattttgaattcatcggctcttcggcaaattgcagaaggcaccagtatctctgaaatgtggcaaaatgacttacagccattgctgatagagcgatacccgggatcccctggaagctatgctgctcgtcagcacatcatgcagcgaattcagaggcttcaggctgactgggtcttggaaatagacaccttcttgagtcagacaccctatgggtaccggtctttctcaaatatcatcagcaccctcaatcccactgctaaacgacatttggtcctcgcctgccactatgactccaagtatttttcccactggaacaacagagtgtttgtaggagccactgattcagccgtgccatgtgcaatgatgttggaacttgctcgtgccttagacaagaaactcctttccttaaagactgtttcagactccaagccagatttgtcactccagctgatcttctttgatggtgaagaggcttttcttcactggtctcctcaagattctctctatgggtctcgacacttagctgcaaagatggcatcgaccccgcacccacctggagcgagaggcaccagccaactgcatggcatggatttattggtcttattggatttgattggagctccaaacccaacgtttcccaatttttttccaaactcagccaggtggttcgaaagacttcaagcaattgaacatgaacttcatgaattgggtttgctcaaggatcactctttggaggggcggtatttccagaattacagttatggaggtgtgattcaggatgaccatattccatttttaagaagaggtgttccagttctgcatctgataccgtctcctttccctgaagtctggcacaccatggatgacaatgaagaaaatttggatgaatcaaccattgacaatctaaacaaaatcctacaagtctttgtgttggaatatcttcatttgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 1 open reading frame 2 - transmembrane protease, serine 2 - leucine rich repeat containing 48 - leucine rich repeat containing 48 |