Cart 19 Product Products 3 026,59 € (empty)
-
1 x FLJ20628-h...121,50 € -
1 x Centriolin...259,07 € -
1 x ARHGAP15-R...121,50 € -
1 x PCLO-picco...113,40 € -
1 x KIAA0040-K...113,40 € -
1 x ARHGEF18-r...113,40 € -
1 x BTLA-B and...113,40 € -
1 x RIN1...259,07 € -
1 x NR5A2-nucl...121,50 € -
1 x CTSZ-cathe...121,50 € -
-
1 x Decorin544,00 € -
1 x SFXN3-side...121,50 € -
1 x CRLF3-cyto...121,50 € -
1 x AKAP7-A...113,40 € -
1 x MEIS2-Meis...121,50 € -
-
1 x FXN-fratax...113,40 € -
1 x ARHGAP1...259,07 €
No products
To be determined Shipping
3 026,59 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 026,59 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 026,59 €
Data sheet of MFAP1-microfibrillar-associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MFAP1-microfibrillar-associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC023557 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MFAP1 |
| Origin species: | Human |
| Product name: | MFAP1-microfibrillar-associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC023557 |
| Gene id: | 4236 |
| Gene description: | microfibrillar-associated protein 1 |
| Synonyms: | microfibrillar-associated protein 1; microfibrillar associated protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggtcccaagcgctctcatgaagcaaccgcccattcagtctacggctggggccgtcccagttcgcaatgagaaaggtgagatttcaatggaaaaagtgaaggtaaagcgttatgtgtccggaaaaaggccagactatgcccctatggagtcctcagatgaggaggatgaagaatttcagttcattaagaaagccaaagaacaagaagcagagcctgaggaacaggaggaggattcatccagtgacccccggctacggcgtttacagaaccgtattagtgaagatgtggaagagagattggctcgacatcgaaaaatagtggaacctgaagtggtaggagagagtgactcagaagtagaaggagatgcttggcgcatggaacgagaagacagcagtgaagaagaggaggaggaaattgatgatgaggaaatagagcggcggcgtggcatgatgcgtcagcgagcacaggagagaaaaaatgaagagatggaagtcatggaagtggaagatgagggtcgttctggagaggagtcagaatcagagtctgagtatgaagagtacacagacagtgaagatgagatggagcctcgccttaagccagtcttcattcgaaagaaggaccgagtgacagttcaagaacgtgaagccgaagcattgaaacagaaggagctggagcaggaagcaaaacgcatggctgaggaaaggcgcaagtacacactcaagattgtcgaagaggaaaccaaaaaagagctggaagagaacaagcgatccctggctgcattggatgcactcaatactgatgatgaaaatgatgaggaggaatatgaggcatggaaagttcgagagctaaaaagaatcaagagggacagagaagatcgagaagcgcttgagaaggagaaagcagaaattgaacgcatgcgaaacctgactgaggaagagaggagagctgaacttcgggcaaacggcaaagtcattaccaacaaagctgttaagggcaaatacaagttcttacagaagtattatcaccggggtgccttcttcatggatgaggatgaagaagtatacaagagagatttcagcgctcctaccctggaggatcatttcaataaaaccattcttcctaaagtcatgcaggtcaagaactttggacgctcaggtcgcaccaaatacactcaccttgtggatcaagataccacctcctttgactcagcttggggccaagagagtgcccagaacacaaagttcttcaaacaaaaggcagctggggtacgagatgtatttgagcggccatctgccaagaagcggaaaactacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - xylulokinase homolog (H. influenzae) - hypothetical protein LOC286016 - G elongation factor, mitochondrial 1 - thyroid stimulating hormone receptor |