Cart 28 Product Products 3 626,70 € (empty)
-
1 x C10orf81-c...121,50 € -
1 x TXNDC9-thi...113,40 € -
1 x C5orf4-chr...121,50 € -
1 x C10orf78-c...113,40 € -
1 x C1orf94-ch...121,50 € -
1 x SNX10-sort...113,40 € -
1 x ZSCAN2-zin...113,40 € -
1 x PSMA1-prot...113,40 € -
1 x LRRIQ3-leu...113,40 € -
1 x CPLX1-comp...113,40 € -
1 x SAP30L-SAP...113,40 € -
1 x CTNNBIP1-c...113,40 € -
1 x SSX3-synov...113,40 € -
-
1 x LCE2D-late...113,40 € -
1 x C9orf68-ch...113,40 € -
1 x MRGPRX2-MA...121,50 € -
1 x NPL-N-acet...113,40 € -
1 x RBM4B-RNA...121,50 € -
1 x C16orf52-c...113,40 € -
1 x NSL1-NSL1,...121,50 € -
1 x DRD2-dopam...121,50 € -
1 x CTF1-cardi...113,40 € -
-
1 x CLK2-CDC-l...121,50 € -
-
-
No products
To be determined Shipping
3 626,70 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 28 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 626,70 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 626,70 €
Data sheet of TMEM173-transmembrane protein 173 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM173-transmembrane protein 173 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047779 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM173 |
| Origin species: | Human |
| Product name: | TMEM173-transmembrane protein 173 Gene |
| Size: | 2ug |
| Accessions: | BC047779 |
| Gene id: | 340061 |
| Gene description: | transmembrane protein 173 |
| Synonyms: | ERIS; MITA; MPYS; NET23; SAVI; STING; hMITA; hSTING; stimulator of interferon genes protein; N-terminal methionine-proline-tyrosine-serine plasma membrane tetraspanner; endoplasmic reticulum IFN stimulator; endoplasmic reticulum interferon stimulator; mitochondrial mediator of IRF3 activation; transmembrane protein 173 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccccactccagcctgcatccatccatcccgtgtcccaggggtcacggggcccagaaggcagccttggttctgctgagtgcctgcctggtgaccctttgggggctaggagagccaccagagcacactctccggtacctggtgctccacctagcctccctgcagctgggactgctgttaaacggggtctgcagcctggctgaggagctgcgccacatccactccaggtaccggggcagctactggaggactgtgcgggcctgcctgggctgccccctccgccgtggggccctgttgctgctgtccatctatttctactactccctcccaaatgcggtcggcccgcccttcacttggatgcttgccctcctgggcctctcgcaggcactgaacatcctcctgggcctcaagggcctggccccagctgagatctctgcagtgtgtgaaaaagggaatttcaacgtggcccatgggctggcatggtcatattacatcggatatctgcggctgatcctgccagagctccaggcccggattcgaacttacaatcagcattacaacaacctgctacggggtgcagtgagccagcggctgtatattctcctcccattggactgtggggtgcctgataacctgagtatggctgaccccaacattcgcttcctggataaactgccccagcagaccggtgaccatgctggcatcaaggatcgggtttacagcaacagcatctatgagcttctggagaacgggcagcgggcgggcacctgtgtcctggagtacgccacccccttgcagactttgtttgccatgtcacaatacagtcaagctggctttagccgggaggataggcttgagcaggccaaactcttctgccggacacttgaggacatcctggcagatgcccctgagtctcagaacaactgccgcctcattgcctaccaggaacctgcagatgacagcagcttctcgctgtcccaggaggttctccggcacctgcggcaggaggaaaaggaagaggttactgtgggcagcttgaagacctcagcggtgcccagtacctccacgatgtcccaagagcctgagctcctcatcagtggaatggaaaagcccctccctctccgcacggatttctcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - syntaxin binding protein 3 - SHQ1 homolog (S. cerevisiae) - histone cluster 2, H2ac - transmembrane channel-like 7 |